Labshake search
Citations for Bio-Rad :
101 - 150 of 9008 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% (v/v) anhydrous 2-mercaptoethanol (#1610710XTU, Bio-Rad, Hercules, CA, USA). The resulting mixture was then boiled for 15 min and then 35 µl of each sample was loaded into individual wells of 10–20% ...
-
bioRxiv - Genetics 2019Quote: ... the size of the amplicon was determined by comparison with a 2-kb DNA marker with the use of Quantity One software (version 4.6.7; Biorad), and the number of repetitions was estimated by comparing the size of the product amplified from the Nichols strain ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% w/v CA and treated with (7% w/v) Chelex100 resin (Bio-Rad, Mississauga, ON, Canada) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Additional pre-absorption controls were performed in which the anti-IL-6 antibody was incubated overnight at 4 °C with a 10 fold molar excess of recombinant chicken IL-6 (1.67 μM; Bio-Rad Laboratories, Inc.) before immunolabeling fixed sections of chick ocular tissues ...
-
bioRxiv - Neuroscience 2019Quote: ... 5uL of the sample was loaded into 4-6% polyacrylamide gel along with Precision Plus Protein™ Dual Color Standard (#1610374S, Bio-Rad) and was run at 120 V ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were isolated from cell homogenate by centrifugation and counted on an automated cell counter (TC20 BioRad, range 4-6 um). Transposition of 100k (weeks 1 ...
-
bioRxiv - Immunology 2022Quote: ... for 2 hours at 4 °C using Mini-trans blot wet tank transfer (BioRad). After transfer ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were assessed using 6% polyacrylamide gel (made with 29:1 Acrylamide/Bis Solution, Bio-Rad) electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... diluted 1:1,000 in 6% milk in PBS-T followed by α-mouse IgG HRP (Bio-Rad) diluted 1:5,000 in 6% milk in PBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: 6-well culture plates were coated with 1 ml of 0.6 % Low Melt Agarose (Bio-Rad; 1613111). Cells were diluted at a density of 1.0 x 104 cells/ml in media containing 0.3% Low Melt Agarose and seeded 1 ml/ well ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-tubulin YL1/2 (dilution 1:50; Biorad) and guinea-pig anti-Ana1 (dilution 1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... 2% formaldehyde gel and separated at 125-150V at 4°C for 1-2 h and then transferred to a Zeta-Probe GT membrane (Bio-Rad) via capillary action overnight (Streit et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by heat-inactivation at 75°C for 5 min and desalting using Micro Bio-Spin P-6 columns (Bio-Rad, 7326221). Dephosphorylated guide RNAs were then radiolabeled using T4 Polynucleotide Kinase (0.33 U/µL ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Excess compounds were removed by Bio-Gel P-6 columns (Biorad) according to the manufacturer’s protocol ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... by using gel filtration with P-6 Bio-Spin columns (BioRad). The resulting protein concentration was estimated to be ∼1-2 µM before native MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... Following clean up with Micro Bio-Spin 6 columns (Bio-Rad), the 3’-end-labeled RNA was incubated with RNase A (Thermo Scientific(tm) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were separated on 6-10 % SDS-polyacrylamide gels or 4-20 % Mini-PROTEAN TGX precast gradient gels (Bio-Rad, CA, USA) together with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Immunology 2022Quote: ... samples were mixed 1:1 with 2 x native sample buffer (BioRad) and loaded on a 4-20% precast protein gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Protein analysis was performed using Bioplex assays (27-Plex, CXCL-1-, CXCL-2-, CXCL-5-, CCL22-single plex) (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... followed by washes at room temperature (1 x 15 min, 2 x 5 min) and incubation with HRP-conjugated secondary antibodies (Bio-Rad) for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: Purified SARS-CoV-2 N protein was electrophoresed on 4-10% SDS-PAGE (Bio-Rad) and stained with Coomassie Brilliant Blue G-250 (CBBG-250) ...
-
bioRxiv - Immunology 2019Quote: ... Rosa26LSL-tdTomato/+ animals (6-12 weeks) were given 1 μg of FITC-conjugated rat anti-CD169 antibody (BioRad) diluted in a total volume of 20 μl of PBS into the right footpad to label CD169+ subscapular macrophages inside the draining LN ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 mM EDTA in 99.9% deuterium oxide using a spin desalting column (Micro Bio-Spin 6, BioRad). 15N-HSQC spectra were measured every 40 min for 106 hours at 25 °C on Bruker 600 MHz NMR spectrometer ...