Labshake search
Citations for Bio-Rad :
101 - 150 of 3755 citations for 7 3 Chloropropoxy 4 chloroquinazoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2023Quote: ... 4% low-melt agarose (BioRad) was prepared in 100 mM sodium cacodylate buffer and kept liquid at 70 °C until needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µg of each extract was loaded on 7-12% precast SDS-polyacrylamide gels (Bio-Rad). After transference ...
-
bioRxiv - Microbiology 2019Quote: ... For WB proteins were transferred (25 V, 1.3 A, 7 min) onto nitrocellulose membranes (Bio-Rad) using Bio-Rad Trans Blot Turbo Transfer system ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Microbiology 2021Quote: ... and final extension at 72°C for 7 min using a C1000 Touch Thermal Cycle (BIO-RAD). PCR results were run on 1% agarose gels and imaged using an iBright CL1500 Imaging system (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).