Labshake search
Citations for Bio-Rad :
101 - 150 of 3941 citations for 4 Nitrophenyl beta D glucuronic acid sodium salt since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Quantity One 1-D Analysis Software (Bio-Rad) was used to estimate band intensities of each sample ...
-
bioRxiv - Immunology 2021Quote: ... and DiaClon Anti-D (Bio-Rad, Basel, Switzerland) were used ...
-
bioRxiv - Microbiology 2021Quote: ... Bound proteins were eluted into sodium dodecyl sulfate (SDS) sample buffer (Bio-Rad) containing 5% 2-mercaptoethanl (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5% sodium deoxycholate) and 7.5uL of 4X Laemmli buffer (1610747; BioRad, Hercules, CA) and run on 10-20% Criterion Tris-HCl gels (3450042 ...
-
bioRxiv - Neuroscience 2024Quote: ... Urea and Sodium dodecyl sulfate (SDS) were purchased from Bio-Rad (Hercules, CA). Acetonitrile and water for nano-LC−MS/MS were purchased from J ...
-
bioRxiv - Immunology 2024Quote: ... Adherent cells were lysed in sodium dodecyl sulfate (SDS) sample lysis buffer (BioRad). Proteins were separated by gel electrophoresis on a 10% Tris-Glycine gel (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein samples were mixed with LDS sample loading buffer at 4X concentration followed by addition of beta-mercaptoethanol (5%) (Bio-Rad, Hercules, CA). The resultant mixture was denatured at 95°C for 9 min ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC-conjugated integrin β1 (CD29, HM beta 1-1, #MCA2298) and FITC-conjugated integrin β3 (CD61, #MCA2299) were from Bio-Rad (Oxford, UK). CHRONO-LUME® was from Chrono-log Corporation (Labmedics ...
-
bioRxiv - Neuroscience 2020Quote: ... These proteins were then subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (Bio-Rad) and transferred onto PVDF membranes (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: Sodium-Dodecyl-Sulphate (SDS) Polyacrylamide Gel Electrophoresis was done in precast gels (Bio-Rad TGX Mini-Protean 4-15% gels with Dual Colour Standard ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Proteins (10-50 µg) were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel (BioRad), separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Immunology 2024Quote: ... Whole-cell lysates (RIPA buffer) separated on 10% sodium dodecyl sulfate-polyacrylamide (Bio-Rad) gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Genetics 2023Quote: ... and Quantity One 1-D analysis software (Bio-Rad). Band density was normalized to the background and statistically analyzed by Student’s t-test in Prism 9 software.
-
bioRxiv - Genetics 2023Quote: ... and analyzed with D-10 Hemoglobin Analyzer (Bio-Rad).
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... 4× Laemmli buffer and 4-20% SDS-PAGE gels were purchased from BioRad.
-
bioRxiv - Microbiology 2024Quote: ... The protein was eluted the next day and was buffer exchanged into a low salt buffer (75mM HEPES, pH 7.6, 100mM KCl, 10% glycerol, 2mM DTT) using a 10-DG column (Bio-rad) for further purification ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified GroEL and GroES were first buffer-exchanged into RNC low-salt buffer using Micro Bio-Spin 6 Columns (Biorad) to remove any traces of Tris-HCl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dharmacon, Cambridge, UK) or siRNAs targeting MYC (D-003282-14 & D-003282-35, Dharmacon) using siLentFect transfection reagent (1703362, Biorad, Hercules, CA, USA) (see Table S4 for siRNA sequences) ...
-
bioRxiv - Neuroscience 2021Quote: ... Target proteins were detected by chemiluminescence with Clarity™ (Beta-actin and GFP) and Clarity Max™ (SP) Western ECL Substrate kit (Bio-Rad®) on the Odyssey FC system (LI-COR) ...
-
bioRxiv - Bioengineering 2024Quote: ... with adding 1:20 Beta-mercaptoethanol and 15 µL of the mixture was added onto Any kD™ Criterion™ TGX Stain-Free™ Protein gel (Bio-Rad). 5 µL of Precision Plus Protein™ Unstained Protein Standards (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... and interleukin 4 (IL-4)) cytokines run on a Bio-Plex 200 reader (BioRad). Data was collected from only two donors for RANTES ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... dissolved in a sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (Bio-Rad) and separated on 15 % SDS-PAGE gels following the Laemmli method (Laemmli ...
-
bioRxiv - Neuroscience 2022Quote: ... A 12% sodium dodecyl sulfate-polyacrylamide gel was prepared according to manufacturer’s protocol (BIO-RAD). For the analysis 32 μl of the production supernatant was mixed with 8 μl 5xLaemmli buffer containing ß-Mercaptoethanol and incubated for 10 min at 95°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... miR-146a-loaded MLNPs were lysed with 0.5% sodium dodecyl sulfate (SDS) (BioRad, Hercules, CA), and loaded onto 2% agarose (Fisher BioReagents ...
-
bioRxiv - Bioengineering 2024Quote: ... in 0.1M sodium phosphate buffer pH 7.3 previously treated with Chelex 100 chelating resin (BioRad), and reacted at 4°C for 18 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ul of suspended cells were then added to a 10ul solution of 0.4% trypan blue in a buffered isotonic salt solution (Bio-Rad, #1450021), pH 7.3 ...
-
bioRxiv - Microbiology 2023Quote: ... Lactose and salts were removed by gel filtration chromatography over a BioRad P2 column (100 cm x 316 mm, Bio-Rad) using a semi-automated fast protein liquid chromatography (FPLC ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bones were then decalcified by rocking in 19 % ethylenediaminetetraacetic acid (Biorad, 1610729) for 14 days at 4 °C with solution changes every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with Aminex Fast Acid Analysis and HPX-87H columns (Bio-Rad) at 55°C and 2 mM H2SO4 as the eluent at a flow rate of 0.5 ml min-1 ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated on a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis precast gel (Bio-Rad), and transferred onto polyvinylidene difluoride (PVDF ...