Labshake search
Citations for Bio-Rad :
101 - 150 of 636 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bones were then decalcified by rocking in 19 % ethylenediaminetetraacetic acid (Biorad, 1610729) for 14 days at 4 °C with solution changes every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with Aminex Fast Acid Analysis and HPX-87H columns (Bio-Rad) at 55°C and 2 mM H2SO4 as the eluent at a flow rate of 0.5 ml min-1 ...
-
bioRxiv - Neuroscience 2022Quote: After 9-13 days in culture, organotypic hippocampal slices were transfected biolistically with gene gun (McAllister, 2000) using gold beads (Bio-Rad, 1.6 µm) coated with plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Sixty μg of each protein sample was run on 9% polyacrylamide gels and transferred to a nitrocellulose membrane with the Turbo Blotdry blot system (Biorad, Hercules, CA, USA). After transfer ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737, Bio-Rad]) and sufficient water to reach a final volume of 20 µL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Immunology 2022Quote: ... cell debris was removed by centrifugation and clear supernatants were diluted 10-fold and subjected to anion exchange chromatography on gravity fed columns using AG-1 9 8 resin (formate form, 100–200 mesh size, Bio-Rad Laboratories, Hercules, CA). Fractions containing inositol mono ...
-
bioRxiv - Physiology 2020Quote: ... The same blood samples were used to analyze the fluctuations in cytokine profiles using Bio-plex (GI 23-Plex and GII 9-Plex: Bio-Rad, Hercules, CA, USA), in accordance with the manufacturers’ instructions.
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total protein lysate concentrations were quantified using a bicinchoninic acid (BCA) assay (BioRAD) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... An organic acid column (Aminex HPX-87H 300 × 7.8 mm, Bio-Rad, USA) was employed for the analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein content was determined with a bicinchoninic acid reagent (Bio-Rad, Hercules, CA). Equal loading was verified in a twin run of electrophoresed individual strips of protein stained with Ponceau S (Sigma ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with a refractive index detector following isocratic elution on a Aminex HPX-87H column (300 x 7.8 mm, 9 µm particle size; Bio-Rad Laboratories, CA, USA, cat. # 1250140) for a total run time of 20 min employing 5mM H2SO4 as mobile phase buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Biophysics 2024Quote: ... 0.2% (w/v) Bio-Lyte 3/10 Ampholyte (BioRad), 1% bromophenol blue) ...
-
bioRxiv - Biochemistry 2020Quote: ... acetylated O-glycans were passed through H+ acid foam (Biorad; Cat. No. 142-1441) and lyophilized ...
-
Efficient breeding of industrial brewing yeast strains using CRISPR/Cas9-aided mating-type switchingbioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the soluble fraction was loaded onto a nickel-nitrotriacetic acid column (Bio-Rad), and proteins were purified according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad, USA) was equilibrated with 5 mM sulphuric acid (H2SO4 ...
-
bioRxiv - Genomics 2023Quote: ... The total protein concentration was determined using the Bicinchoninic Acid (BCA) assay (Bio-Rad). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... and applied onto an nickel(II)-nitrilotriacetic acid (Ni-NTA) IMAC column (Bio-Rad) on a chromatography platform (NGC ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Biophysics 2021Quote: ... The soluble fraction was loaded onto a nickel-nitrilotriacetic acid column (Bio-Rad, Hercules, CA) and proteins were purified following the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: ... organic acids and glycerol were measured using an HPX-87H column (Bio-Rad, CA, USA) at 45°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Acid-treated fiber spreads were incubated with 1/1000 rat anti-BrdU mAb (Bio-Rad) for 1.5 hour to detect CldU ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were measured after sonication by the bicinchoninic acid assay (Bio-Rad, Hercules, CA), and equal amounts of fragmented chromatin–protein complexes were incubated for 2 h with enclosed Dynabeads coupled to rabbit anti-Polβ (Ab26343 ...
-
bioRxiv - Systems Biology 2024Quote: Metabolites such as sugars and acids (e.g. lactate and acetate) were measured by Bio-Rad HPX-87H column at 65 °C with 5 mM sulfuric acid as a mobile phase using a Thermo high-performance liquid chromatography (Ultimate 3000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was collected for quantification using the bicinchoninic acid protein kit (Bio-Rad, USA).
-
bioRxiv - Biochemistry 2020Quote: ... Plates were blocked with 3% nonfat dry milk (BioRad, P1379) in 1xPBS for 1 hour ...