Labshake search
Citations for Bio-Rad :
101 - 150 of 3549 citations for 3 1H Pyrrol 1 yl phenyl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The embryos were mounted on a 2 % agarose pad and heat-shocked at 30°C for 1h (Thermocycler Bio-Rad). After 2h recovery at 20°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 20% DMSO and 0.3M Glycine for 1h followed by a blocking step using an aqueous solution of 0.2% Triton X100 (Bio-Rad Laboratories), 0.2M Tris pH8 ...
-
bioRxiv - Cell Biology 2023Quote: ... And then blots were probed with secondary antibodies for 1h at room temperature before ECL development and imaging (Bio-Rad). The primary antibodies used for immunoblotting are as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was stopped by a final methanol-chloroform-H2O precipitation and resuspended in laemmli buffer (Bio-Rad) for WB analysis.
-
bioRxiv - Neuroscience 2022Quote: ... The transfer sandwich was made using PVDF membrane (activated in methanol) in Tris-Glycine transfer buffer (Bio-Rad) with 20% methanol and transferred for 2 hours at 30V ...
-
bioRxiv - Cell Biology 2024Quote: ... Separated proteins were transferred using a Trans Blot Turbo system on methanol-activated LF-PVDF membranes (Bio-Rad). Protein transfer was assessed following instructions for Stain-Free technology (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were then washed in PBS and blocked for 1h in 20 mm Tris Buffered Saline with 0.1% Tween-20 (BioRad, catalog #1610781) (TBS-T ...
-
bioRxiv - Immunology 2024Quote: ... the proteins were transferred to a polyvinylidene difluoride membrane (110V, 1h, 4°C) using a Mini Trans-Blot cell apparatus (Bio-Rad). Non-specific binding sites were blocked using PBS/Tween 20 (0.05% Tween 20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nitrocellulose membranes were blocked for 1h at RT in 5% Blotting Grade Blocker Non-Fat Dry Milk (Biorad, Hercules, CA, USA) and TBST ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.1% SDS, pH ~8.6), wet transferred @ 100V for 60 min to methanol (Fischer, A412) activated PVDF (BioRad, 1620177) in Towbin transfer buffer containing (25 mM Tris ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were transferred to methanol-treated PVDF membranes using a Mini Trans-Blot Cell wet-transfer apparatus (BIO-RAD), according to manufacturer’s specifications at 400 mA for 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... gel at 150 V for 2 h and transferred onto a PVDF membrane at 25 V for 2 h in transfer buffer (3.03g Tris–HCl, 14.4g glycine, 20% methanol) using a semi-dry transfer apparatus (Bio-Rad). After transfer ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were transferred by wet-blotting with Tris-Glycine buffer (250 mM Tris base, 1.92 M Glycine and 10% methanol) onto a nitrocellulose membrane (BioRad). After completion of the transfer ...
-
bioRxiv - Immunology 2024Quote: ... pre-soaked in transfer buffer (20 mM Tris, 190 mM glycine, 20% Methanol, pH 8.3) using a Mini-Transfer cell (BioRad) for 1.5 hours (100 V constant ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were transferred onto either 0.2 μm pore-size Nitrocellulose membranes or methanol-activated 0.45 μm pore-size PVDF membranes (BioRad, USA), using either the Trans-Blot Turbo Transfer System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Bioengineering 2020Quote: ... the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; 170-6516, Bio-Rad) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were then transferred onto low-fluorescence 0.45 μm PVDF membranes with transfer buffer (10× Tris/glycine with 10% methanol) (Bio-Rad) for 10 min using the semi-dry Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were transferred to PVDF membrane at 4°C for 14.5 h at 30 V using the mini trans-blot module in transblot buffer (10 mM MES buffer pH 6 and 10% (v/v) methanol) according to the supplier’s instructions (Bio-Rad). The membrane was removed from the cassette ...
-
bioRxiv - Microbiology 2020Quote: ... and destained with 30% methanol,10% glacial acetic acid in double distilled water and subjected to film by ChemiDoc systerm (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... the gels were wet transferred at 400 mA for 90 min to methanol-activated 0.2 µm pore size PVDF membrane (Bio-Rad). Blots were blocked in 5% nonfat milk in Tris-buffered saline (0.5 mM Tris-HCl [pH 7.5] and 1.5 mM NaCl ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were transferred onto a polyvinylidene difluoride membrane activated with methanol using the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were probed with mouse StrepMAB-Classic antibody diluted 1:3000 in TBS-T (25 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... 10-20 μg protein per sample were loaded onto SDS-page gels for protein separation and then transferred onto nitrocellulose or methanol-activated PVDF membranes via full-wet transfer assay (BioRad) or semi-wet transfer ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were transferred to xxx membrane (pre-washed in 100% methanol and incubate in buffer blotting 10min) using trans-blot SD semi dry transfer system (Biorad) in RT ...
-
bioRxiv - Bioengineering 2023Quote: ... Protein transfer was performed on methanol-activated polyvinylidene fluoride (PVDF) membranes by Trans-Blot Turbo Transfer system (1704150; Bio-Rad). Post transfer the membranes were blocked in 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Bioengineering 2023Quote: ... Protein transfer was performed on methanol-activated polyvinylidene fluoride (PVDF) membranes by Trans-Blot Turbo Transfer system (1704150; Bio-Rad). After transfer the membranes were blocked in 5% BSA in TBS with 0.1% Tween-20 for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... by semi-dry transfer in 1× transfer buffer (48 mM Tris, 39 mM glycine, 20 % methanol, 0.04 % SDS) using a Trans-Blot Turbo Transfer System (Bio-Rad).
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were then transferred onto a methanol-activated PVDF membrane (Cytiva) using a Mini Trans-Blot Transfer Cell (Bio-Rad) at a constant 200 mA and 4 °C for 2.5 hours in cold transfer buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... A 30µg protein extracts were subjected to denaturing 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membrane preactivated with absolute methanol using Trans-Blot Turbo Transfer System (Bio-Rad). After blocking with 5% powdered skim milk in 1% phosphate buffer solution plus 0.1% Tween-20 (PBST) ...
-
bioRxiv - Cell Biology 2022Quote: ... 192 mM glycine and 20% of methanol) for 15 min before assembly in the Mini Trans-Blot transfer cell (BioRad 1703935). The transfer was done at 4°C for 16 h at 110 mA constant current ...
-
bioRxiv - Microbiology 2022Quote: ... 20% (v/v) methanol) at a constant amperage of 300 mA for 90 min using a Mini Trans-Blot Cell (Bio-Rad). The membranes were incubated in NRA blocking buffer (INNOVAX ...
-
bioRxiv - Immunology 2021Quote: ... 7 μm cryosections were methanol fixed for 20 minutes on ice and stained with an antibody specific to CD68 (clone: ED1, Bio-Rad). Animal protocols were approved by the University of Virginia Institutional Animal Care and Use Committee.
-
bioRxiv - Cell Biology 2023Quote: ... Gels were then stained with Coomassie Blue solution, followed by de-staining (Methanol, Acetic Acid solution) and visualised by using Gel Doc™ XR+ system (BioRad).
-
bioRxiv - Immunology 2022Quote: ... using the transfer buffer (192 mM glycine, 25 mM Tris, 20% methanol) for 20 min at 20 V semi-dry transfer apparatus (BioRad, USA). Blocking was done with 1% BSA for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... or immunoprecipitated samples were resolved by SDS-PAGE (6% to 10%) and transferred onto methanol-treated immun-blot PVDF membrane (Bio-Rad). The membranes were incubated overnight at 4°C with corresponding primary antibodies (antibody information ...
-
bioRxiv - Neuroscience 2024Quote: ... the proteins were blotted onto methanol-activated polyvinylidene difluoride (PVDF) membranes (0.2 µm) with a Trans-Blot SD Semi-Dry Transfer Cell system (Bio-Rad Laboratories). After blotting ...
-
bioRxiv - Immunology 2024Quote: ... Protein was transferred to an Immobilon-FL polyvinylidene difluoride membrane with 2x NuPAGE transfer buffer supplemented with 10% methanol at 15 V for 15 min using a Transblot Turbo semi-dry transfer system (Bio-Rad). After transfer ...
-
bioRxiv - Molecular Biology 2023Quote: ... gels were rinsed with Towbin buffer (25 mM Tris, 192 mM glycine, 20% methanol) and transferred in BioRad Trans-Blot Turbo (Bio-Rad) for thirty minutes at 15 V ...