Labshake search
Citations for Bio-Rad :
1401 - 1450 of 8278 citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and loaded onto 2 mL Nuvia IMAC Ni-charged resin (Bio-Rad Laboratories). The resin was washed with 10 column volumes of buffer containing 5 mM imidazole ...
-
bioRxiv - Biophysics 2023Quote: ... The motility surface was coated with 0.8% anti-tubulin antibody (BioRad YL1/2) in BRB-80 buffer for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... and 7.5 ul of 2× iQ SYBR green super mix (Bio-Rad Laboratories) was used.
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Bioengineering 2024Quote: ... for 2 min and immediately imaged using a ChemiDoc MP instrument (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... Proteins were denatured by addition of 2× Laemmeli SDS loading buffer (Bio-Rad) plus β-mercaptoethanol (5% vol:vol ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR reactions were performed on a MJ Opticon 2 (Bio-Rad) using Green Taq DNA polymerase (GenScript ...
-
bioRxiv - Biochemistry 2024Quote: ... The pentaethylene glycol monodecyl was removed by SM-2 bio-beads (Bio-Rad): five additions of bio-beads were made to the master mix every 20 minutes with inversion at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Gr-1 (1:500, MCA2387, Bio-Rad), Fluorescein labeled DBA-lectin (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA samples (3 μl) and master mixes (7 μl) were pipetted into a 96-well PCR plate (Bio-Rad #MLL9651) and PCR amplification performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Immunology 2020Quote: Densitometric analysis of cleaved caspase 3 immunoblots from three independent experiments were performed using the VersaDoc Imaging System (Bio-Rad) and analyzed with ImageJ 1.52p Fiji package software (https://imagej.net/Fiji) ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein bound GST beads were washed 3 times in the GST lysis buffer by centrifugation at 1,000 rcf for 3 minutes and resuspended in 4X Laemmli sample buffer (Bio-Rad), heat denatured and centrifuged at 1,000 rcf for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were centrifuged for 5 min at 7,000 g and washed twice with 200 μL of 1x PBS containing 3% BSA and 0.1% (v/v) Tween-20 (BioRad, Germany). Mounting of cells for STED microscopy was performed as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were in-gel rehydrated for 16 hrs and isoelectrically focused on 7 cm pH 3-10 IPG strips to 10,000 Vh on a Protean® IEF Cell (BioRad). After focusing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 3 technical replicates and were carried out using a CFX384 TouchTM Real-Time PCR Detection System (BioRad Laboratories Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were run in 3-12% Bis-Tris gradient gels and transferred to PVDF membranes in a wet blot system (BioRad). Membranes were dried ...
-
bioRxiv - Microbiology 2020Quote: ... were mixed in a 1000:3 ratio and added to the blots prior to visualization via Chemidoc Touch Imaging system (BioRad). For OmpT visualization ...
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2022Quote: ... 3-Hydroxypropionate samples were eluted through a 300 mm × 7.8 mm Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) at 55 °C using 5 mM H2SO4 (flow rate 0.6 mL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA and RNA were sheared through sonication and dotted (3 µg) on the nitrocellulose membrane (BIO-RAD, Cat No: 1620112). The membrane was baked at 80⁰C for 2 h and blocked-in phosphate-buffered saline (PBS-Tween 0.05% ...
-
bioRxiv - Cell Biology 2022Quote: ... and assays (Table S3) were used for real-time qPCR (Thermo Fisher, Applied Biosystems QuantStudio 3 and BioRad CFX 384) to determine CXCL12 ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR program was run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (#1725121, Bio-Rad, Hercules, CA,) using human Il6 and mouse B2m ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...