Labshake search
Citations for Bio-Rad :
1401 - 1450 of 5928 citations for 6 hydroxy 4 6 dihydrofuro 3 2 c pyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... and data were analyzed using Quantity One (Bio-Rad, USA). For the dsDNA cleavage assays ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were analysis by Quantity One BioSoft (BIO-RAD). Relative expression levels were normalized to that of tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... and quantified using Quantity One version 4.1.0 software (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... and quantified using The Quantity One software v4.6.3 (Bio-Rad). Optical density values for CB1R were normalized to actin optical density values as loading control in the same sample and expressed as a percentage of control group (WT).
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization results were quantified using Quantity One® (Bio-Rad) software ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound DNA was quantified by the Quantity One software (BioRad). The gel was subsequently stained with Simply Blue (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The analysis was done with the Quantity One software (BioRad). The experiment was conducted in five biological replicates.
-
bioRxiv - Physiology 2022Quote: ... Densitometry was performed using Quantity One 4.6.9 software (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... with cumulative image recording using the Quantity One software (Biorad).
-
bioRxiv - Cancer Biology 2019Quote: ... then one hour and twenty minutes at 120 volts (Biorad) at 4oC ...
-
bioRxiv - Plant Biology 2020Quote: ... radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Densitometric scans were analyzed using Quantity One software (Bio-Rad). The value of the ricin band was determined as a percentage of the total protein in each lane ...
-
bioRxiv - Genetics 2021Quote: ... were quantified with Quantity-One software (Bio-Rad Laboratories, America). Sample in western blot was triplicate.
-
bioRxiv - Cancer Biology 2021Quote: ... The iTaq Universal SYBR Green One-Step Kit (Bio-Rad) was used to run the RT-qPCR reactions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Biophysics 2020Quote: ... The supernatant was incubated with amylose resin for 1 h at 4°C and loaded onto a 20 ml chromatography column (Bio-Rad, Hercules, CA, USA). After washing 3 column volumes with wash buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2020Quote: ... Cell suspensions were clarified by centrifugation (20 000 x g, 10 minutes, 4°C) and total soluble protein quantified58 using a kit (Bio-Rad Protein Assay Kit) and BSA as a standard.
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were denatured for 5 min at 95°C and gel was run using a 4-20% Mini-PROTEAN ® TGX precast protein gels (Bio-Rad, No. 4561094). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins extracts were boiled at 95°C and then separated onto Mini-PROTEAN ® TGX™ precast protein SDS-PAGE (4-15% gradient) gels (BIO-RAD, #4561083). Proteins were transferred onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were clarified for 5 min at 10,000 × g at +4□C and protein concentration was determined using DC Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). For immunoprecipitation ...
-
bioRxiv - Immunology 2020Quote: ... of protein were incubated in 1X Laemmli buffer with 0.1 M dithiothreitol at 65°C for 15 min and electrophoresed on 4-15% gradient TGX gels and transferred to PVDF membranes (Bio-Rad Laboratories, Mississauga, Canada). The membranes were blocked with Tris-buffered saline with 0.05% Tween 20 (TBST) ...
-
bioRxiv - Genetics 2020Quote: ... diluted samples were boiled for 5min at 95 °C and subsequently separated on a 4-15% Criterion™ TGX Stain-Free™ Protein Gel (Bio-Rad Laboratories) and ran in a Criterion™ Cell geltank (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... by tank blotting at 250mA for 90 min in a cold room (4 °C) in blotting buffer (catalog#1610734, Bio-Rad, Hercules, CA, USA). The membrane was blocked for 2 h in TBS-T (tris buffered saline supplemented with 0.1 % Tween ...
-
bioRxiv - Neuroscience 2023Quote: ... and denaturated by β-mercaptoethanol at 75°C before loading 20-30 µg protein onto 4-20% Mini-PROTEAN TGX Stain-FreeTM Protein Gels (Bio-Rad, Hercules, CA, USA) and electrophoresed at 120 V for 120 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and denaturated by β-mercaptoethanol at 75°C before loading 50-60 µg protein onto 4-20% Mini-PROTEAN TGX Stain-FreeTM Protein Gels (Bio-Rad, Hercules, CA, USA) and electrophoresed at 120 V for 120 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 40ug of each sample was denatured at 95°C for 5 minutes and loaded in 4–20% Mini-PROTEAN® TGX™ Precast protein gels (Bio-Rad; SA) with a gel lane including a Dual Xtra standard protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... were harvested and resuspended in 1X PBS-NaN3 (0.2%) and embedded in 2% low-melt agarose (Mb grade, BioRad). Agarose plugs were chilled at 4°C for 30 min and then ejected into Proteinase K digestion buffer (1 mg/mL proteinase K ...
-
bioRxiv - Biophysics 2022Quote: ... Nanodisc reconstitution was induced by removing detergent with 0.8 mg ml-1 pre-washed Biobeads SM-2 (Bio-Rad) for 2 hours with gentle agitation at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated in 2-mm cuvettes (600 V, 50 μF, 200 Ω) by using Gene Pulser Xcell (Biorad). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... resolved by size on a 2% agarose gel and imaged on Gel Doc XR+ and ChemiDoc XRS+ systems (Biorad).
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
bioRxiv - Pathology 2019Quote: ... by SDS-PAGE at 100 V for 2 hours in a Mini-PROTEAN® Tetra cell apparatus (Bio-Rad). The Kaleidoscope commercial standard Precision Plus Protein Standard (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse Transcription cDNA synthesis reactions were performed on 0.2 μg −2 μg total RNA with iScript cDNA synthesis kit (BioRad) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... The cDNA was then diluted 10x with water and 2 µl was mixed with iQ SYBR Green Supermix (BioRad) containing 100 nM of forward and reverse primers ...
-
bioRxiv - Genetics 2020Quote: ... 2 mM ATP and 1 mM DTT and the reactions were stopped by addition of Laemli sample buffer (BioRad). Samples were run on precast 4-20% gradient SDS-PAGE gels (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed in 20 μL reactions in triplicate containing 10 μL 2 × SsoFast EvaGreen Supermix (Bio-Rad,), 1 μL of primers (3 μM F and 3 μM R) ...