Labshake search
Citations for Bio-Rad :
1351 - 1400 of 10000+ citations for Human Immunodeficiency Virus P24 Protein HIV 1 Clade C since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Microbiology 2022Quote: ... the samples were washed extensively with lysis buffer and the proteins were eluted by boiling 5 ul of the resin with 5x SDS loading buffer and the proteins were detected by western blot analysis using rabbit antibody to FLAG (1:2,000, BioRad) or mouse antibody to Myc (1:2000 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL protein was injected onto either a self-packed buffer exchange column (P6 polyacrylamide gel, Bio-Rad Laboratories) or a prototype desalting column from Thermo Fisher Scientific and online buffer exchanged to 200 mM ammonium acetate ...
-
bioRxiv - Bioengineering 2021Quote: ... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
bioRxiv - Pathology 2022Quote: ... The expression levels of target proteins were quantified with Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Genomics 2019Quote: ... All blots were visualized using a goat anti-rabbit IgG:alkaline phosphatase fusion protein at 1:3,000 dilution in conjunction with BCIP/NBT color development (Bio-Rad).
-
bioRxiv - Genetics 2023Quote: ... ∼25 μL sample was run out on a 7.5% SDS-PA at 150V for ∼1 h alongside a protein standard (BioRad Precision Plus Protein Dual Color Standard) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and aliquots were 1:50 in water prior to Bradford protein assay (Bio-Rad, Hercules, CA, USA, Cat# 5000006). Samples were then normalized to 1 mg/mL protein in 0.1% Azo prior to reduction with 30 mM DTT at 37C for 1 h and alkylation with 30 mM chloroacetamide for 45 min ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Physiology 2019Quote: ... initiation at 95°C/10 s followed by 45 amplification cycles (60°C/15 s) on the CFX Thermal cycler (Biorad).
-
bioRxiv - Systems Biology 2021Quote: ... followed by 15 s at 95 °C and 60 s at 58 °C for 40 cycles using Biorad CFX384 thermocycler (Biorad). The mRNA levels of genes encoding cytokine expression were normalized relative to the mean levels of the housekeeping gene and compared using the 2−ΔΔCt method as described previously2 ...
-
bioRxiv - Systems Biology 2020Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad).
-
bioRxiv - Microbiology 2020Quote: ... 73105b and 73106f pseudotyped viruses were incubated at temperatures from 37°C to 50°C for 60 minutes using temperature gradient on PCR thermal cycler (BioRad). Pseudoviruses were then aliquoted in a 96-well culture plate ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR was carried out in triplicates and was performed at a 2-step reaction with 95°C denaturation and 56°C annealing and extension for 35 cycles on a CFX96 Real-Time System (BIORAD). Relative quantification of target genes was determined using Bio-Rad CFX manager 3.1 software ...
-
bioRxiv - Neuroscience 2022Quote: ... then denatured for 5 min at 95°C and annealed by gradual cooling down at −0.1 °C/sec using a PCR thermocycler (BioRad T100). Annealed oligos were subsequently inserted into BbsI-digested vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Zoology 2022Quote: ... and folded by heating to 95°C for 2 min and slowly cooling down at 0.1 °C per second using a thermocycler (Bio-Rad). DsRNA concentrations were adjusted to 3 or 14 μg / μl using SpeedVac Concentrator (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 40 cycles of 95 °C for 5 sec and 60 °C for 30 sec using the CFX 96 real-time systems (Biorad). The 2−ΔΔCt method was used to analyze the data (Schmittgen and Livak ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR with CFX Manager software (Bio-Rad). Melting temperatures were calculated with DSFWorld27 (by model 2).
-
bioRxiv - Systems Biology 2023Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad). The results were normalized to GAPDH from the same well ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by 15 minutes at 50°C and 5 minutes at 85°C in T100 Thermal Cycler (1861096, Bio-Rad). Real-time qPCR reactions were performed using SsoAdvanced Universal SYBR® Green Supermix (1725274 ...
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (5 s at 95°C followed by 20 s at 60°C) in a CFX Opus 96 Real-Time PCR System (BioRad). Results were analyzed by the Comparative Ct Method (ΔΔCt Method ...
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 s at 95°C and 30 s at 60°C in a CFX96 cycler (Biorad). Primers are listed in Additional file 1.
-
bioRxiv - Plant Biology 2024Quote: ... using 45 cycles of 15 sec at 95°C and 30 sec at 60°C in a CFX96 cycler (Biorad). Data were normalized to the transcript encoding PP2A subunit A3 (At1g13320 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Microbiology 2022Quote: ... The melt curve analysis was performed at 65°C for 1 minute in CFX connects TM Real-time PCR detection system (Bio-Rad, USA). The primers used are listed inTable 1 ...
-
bioRxiv - Immunology 2019Quote: ... Upfront tagmentation of ~35,000 nuclei was performed for 1 h at 37°C in a C1000 Touch thermal cycler with 96-Deep Well Reaction Module (Bio-Rad, 1851197). Tagmented nuclei were mixed the master mix and loaded onto a Chromium Chip with Gel beads and partitioning oil on different wells ...
-
bioRxiv - Bioengineering 2023Quote: ... before injecting into 1 mL Hitrap Heparin HP column pre-equilibrated with Wash Buffer C operated in the BioLogic DuoFlow™ FPLC system (Bio-rad). The protein was eluted from the column by running a gradient flow rate that exchanges Wash Buffer C and Elution Buffer D (2000 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... The mixture was incubated for 1-2 h at 4 °C and incubated overnight with pre-washed bio-beads (Bio-Rad Laboratories) at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... This mixture was then incubated at 4 °C for 1 hour and further subjected to a 4-hour incubation with bio-beads (Bio-Rad, USA). After incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... applying a constant current of 300 mA at 4°C for 1 hour using a Mini Trans-Blot® Cell (Bio-Rad). For the immunodetection of specific protein targets ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...