Labshake search
Citations for Bio-Rad :
1301 - 1350 of 4563 citations for 6 CHLORO 2 PIPERIDIN 4 YL 1H BENZO D IMIDAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was resolved by 10% or 4-20% SDS-PAGE TGX precast gels (Biorad) and transferred to nitrocellulose membrane using Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were separated on precast 4–20% Criterion TGX gels (Bio-Rad). Probe-labeled proteins were analyzed by in-gel fluorescence using a ChemiDoc MP (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... SDS-PAGE electrophoresis was performed on 4-15% gradient gels (Bio-Rad #4561084) or 4-20% gradient gels (GenScript #M00656) ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad) and transferred to polyvinylidene difluoride membranes (EMD Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Microbiology 2023Quote: ... samples were loaded on a 4-15% SDS-PAGE precast gel (Bio-Rad) and stain with Coomassie ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Protein extracts were loaded into 4-20% Tris-glycine SDS-PAGE gels (BioRad) and ran at 120 V for 30 minutes in Tris-glycine-SDS buffer (2.5 mM Tris ...
-
bioRxiv - Genetics 2023Quote: ... then transferred overnight at 4°C at 40mAmp to 0.22mm PVDF (Bio-Rad) in Tris·Glycine buffer (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were then loaded on a Mini-PROTEAN TGX Gel 4-20% (BIORAD). After the run ...
-
bioRxiv - Immunology 2023Quote: ... Immunoprecipitated complexes were washed 4 times and eluted using Laemmli buffer (Bio-Rad). Low-molecular-weight protein Western blot was performed as described73 ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were separated on precast 4−20% Criterion TGX gels (Bio-Rad) and were analyzed by in-gel fluorescence using a ChemiDoc MP (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... the samples were separated on precast 4−20% Criterion TGX gels (Bio-Rad). Probe-labeled proteins were analyzed by in-gel fluorescence using a ChemiDoc MP (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... we confirmed the purity of complexes by 4-20% SDS-PAGE (Biorad, #4561096) and Coomassie staining ...
-
bioRxiv - Physiology 2023Quote: ... Samples were loaded into a precast 4–20% polyacrylamide gradient gel (Bio-Rad) and electrophoresed ...
-
bioRxiv - Neuroscience 2023Quote: Samples (20µg protein) were subjected to either 4-15% SDS-PAGE (Bio-Rad), or 10% SDS-PAGE for Tpm-4.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Equal micrograms of samples were loaded onto 4% - 20% Criterion gels (BioRad 5671094) for electrophoresis and used for silver staining or transferred to PVDF (Millipore IPFL00010 ...
-
bioRxiv - Biochemistry 2023Quote: ... Isolated proteins were run on 4– 20% precast SDS-PAGE gels (Bio-Rad) and screened for AMPK ...
-
bioRxiv - Neuroscience 2024Quote: ... All samples were resolved on 4-20% Mini-PROTEAN TGX Precast Gels (BioRad) and transferred to 0.45um nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2024Quote: ... protein samples (30 μg) were loaded on 4 - 20 % gels (# 4561093, Bio-Rad), run at 100 V and transferred to nitrocellulose membranes (# 1704158 ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein samples were loaded into 4 - 20 % precast gradient gels (Biorad, Cat. # 1704158) alongside a page ruler (ThermoFisher ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were resolved via SDS-PAGE using 4-15% Tris-glycine gels (Biorad) and subsequently transferred to PVDF membranes ...
-
bioRxiv - Physiology 2023Quote: ... islets were immobilized in a gel (Bio-Gel P-4, Bio-Rad, USA) in flow chambers ...
-
bioRxiv - Immunology 2023Quote: ... before running on a 4-15% gel (Mini-PROTEAN TGX Precast Gels, BioRad). Protein was transferred onto PVDF membranes (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... The proteins were visualized by running a 4-20% SDS-PAGE (Bio-Rad) and stained with Coomassie blue.
-
bioRxiv - Cancer Biology 2024Quote: ... 4-15% Mini-PROTEAN® TGX™ precast protein gel (Bio-Rad 4561084) and resolved at 120 V ...
-
bioRxiv - Molecular Biology 2024Quote: ... on 4-15% gradient polyacrylamide gel (Mini-Protein TGX precast protein gels, BioRad) by gel electrophoresis at a constant voltage of 200 V in SDS running buffer (25 mM Tris ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: ... Samples were separated on 4-20% Tris-glycine gels (Bio-Rad 456-1096) to examine Srs2 level and active Rad53 form or 7% Tris-acetate gels (Thermo Fisher EA03555 ...
-
bioRxiv - Neuroscience 2024Quote: ... per lane were loaded on 4-12% bis-tris gels (Bio-Rad Laboratories) or 4-15% Tris-glycine gels (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... with proteins being separated on Mini-protean TGX precast gels 4-15% (Biorad). Transfer was done with the Transblot Turbo RTA transfer kit Nitrocellulose and detection was performed with the Clarity Max Western substrate (Biorad ...
-
bioRxiv - Microbiology 2024Quote: Samples were run on 4–20% Tris-HCl SDS-PAGE gels (BioRad Criterion) at 90 V for 40 minutes followed by separation at 150 V for 85 minutes ...
-
bioRxiv - Genomics 2024Quote: ... Samples were run on a 4-20% gradient SDS-PAGE gel (Bio-Rad) and transferred to a nitrocellulose membrane (Bio-Rad Quick transfer) ...
-
bioRxiv - Neuroscience 2024Quote: ... consisting of 4% (vol/vol) of 19:1 acrylamide/bis-acrylamide (BioRad, 1610144), 60 mM Tris⋅HCl pH 8 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein lysates diluted in 4 X Laemmli Sample Buffer (Bio-Rad#161–0747) were loaded onto Bio-Rad 4–20% precast gels ...
-
bioRxiv - Immunology 2023Quote: ... separated on Mini-PROTEAN TGX Stain-Free Precast Gels (4-15%, Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were separated in a 4-20% pre-casted gel (Bio-Rad) and transferred overnight onto nitrocellulose membrane (GE Healthcare) ...
-
bioRxiv - Biochemistry 2024Quote: Proteins were resolved onto a 4-20% Mini-PROTEAN TGX Precast gels (BioRad) and then transferred to a 0.2 μM nitrocellulose membrane (Biorad ...
-
bioRxiv - Biochemistry 2024Quote: ... the samples were separated on precast 4−20% Criterion TGX gels (Bio-Rad). Probe-labeled proteins were analyzed by in-gel fluorescence using a ChemiDoc MP (Bio-Rad) ...
-
bioRxiv - Biophysics 2024Quote: ... The resulting supernatant was run on precast 4-15% Tris Glycine gels (Biorad) at 200V for 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were separated on a 4-20% SDS-PAGE gel (Biorad 4561096, 5671095) and visualized with a Piece Silver Stain kit (Thermo 24612 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and equal protein quantities were then loaded on 4-20% polyacrylamide gels (Biorad) or 4-20% Tris-Glycine gels (Introvigen ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were loaded into precast 4%-20% gradient polyacrylamide gels (Bio-Rad, #4561094) and electrophoresed at 150 V for approximately 35 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were separated on a 4-15% TGX (Tris-Glycine eXtended) (Bio-Rad) and transferred to a PVDF membrane ...
-
bioRxiv - Cancer Biology 2024Quote: ... The proteins were separated by SDS-PAGE on 4-15% gradient gels (Biorad) and transferred on to PVDF membranes using the iBlot Dry Blotting system (Thermofisher) ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell lysates were run on 4-20% Tris glycine gradient gels (Biorad) by SDS-PAGE followed by transfer to polyvinylidenedifluoride (PVDF ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated in 4-20% precast polyacrylamide gels (cat#: 4561096, Bio-Rad) then transferred to nitrocellulose membrane ...
-
bioRxiv - Biophysics 2024Quote: ... samples were loaded on Mini-PROTEAN TGX Precast gel (4-15%, Bio-Rad) and ran in non-denaturing running buffer (25 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Visualisation and quantification were carried out using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and data were analyzed with GraphPad Prism 4 software.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... 40S and 80S fractions were quantified using Quantity One 1-D Analysis Software v.4.1.2 (Bio-Rad Laboratories, Hercules, CA). Pno1 was quantified using ImageJ Software v1.52 (100 ...