Labshake search
Citations for Bio-Rad :
1201 - 1250 of 3412 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 2 µL of the diluted cDNA samples are supplemented with 10 µL of Supermix 2X ddPCR (without dUTP, Bio-Rad, #1863024), 1 μl of target probe (ZEN™ FAM)/primers mix (final concentration of 750 nM of each primer and 250 nM of probe ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA was amplified using the primers listed in Extended Table 2 and the SsoAdvanced universal SYBR Green supermix (Bio-Rad). Amplimers for vacA ...
-
bioRxiv - Neuroscience 2021Quote: ... and purified by passing through a P-30 Tris Micro Bio-Spin Column (Bio-Rad). Prior to hybridization ...
-
bioRxiv - Molecular Biology 2022Quote: ... afterwhich DNA was purified using Bio-Gel P-30 size-exclusion spin column (Bio-Rad). Then DNA was digested with SacI (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and later purified by running through RNase-free P-30 column (Bio-Rad, Hercules, CA). PNK was used to dephosphorylate RNA for 2 hours (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: Micro Bio-Spin™ RNase free P-30 Gel Columns (Bio-Rad, cat. no. 7326250) (optional ...
-
bioRxiv - Molecular Biology 2023Quote: ... Water-resuspended RNAs were applied to Micro Bio-Spin P-30 columns (Bio-Rad, 7326250) for desalting.
-
bioRxiv - Cancer Biology 2023Quote: ... YAP S126-p were purchased from CST and rhodamine-conjugated β-tubulin from Bio-Rad and used for Western blotting ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by purification using Micro Bio-Spin P-30 gel columns (Bio-Rad, Cat#7326223). The purified RNA was quantified using a Nanodrop and diluted to a concentration of 20 ng/μl in hybridization buffer (50% formamide ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-8 mg of 1.6 µm gold beads (BioRad) were coated with 15 µg of EGFP-N1 (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... EG depletion was monitored using on an Aminex HPX-87H ion exclusion column (300 mm x 7.8 mm, particle size 9 μm; Bio-rad). The column was maintained at 40°C and samples were isocratically eluted using 0.014 N H2SO4 at a flow rate of 0.55 ml min-1 and read on a refractive index detector (RID) ...
-
bioRxiv - Immunology 2022Quote: ... Lysates containing 40 μg of proteins were analyzed by SDS-PAGE on 9-13% gels and proteins were transferred onto nitrocellulose membranes (BioRad). The blots were blocked in non-fat milk diluted in tris-buffered saline (TBS ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was isolated from 6-week-old rosette leaves and bolting flower buds of Col-0 and one of the RPF2-atp1 (RPF2-atp1-9) transformed lines (T3) with PureZol reagent (BioRad). Three independent libraries for each genotype were made from total RNA treated with 250 ng of Turbo DNase (Ambion ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All reagents except the double-stranded beacon were first assembled in a total volume of 9 μL and run at 37 °C in a CFX96 real-time PCR detection system (Biorad). Both WT SpCas9 and SpCas9-NG are highly active at this temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Amplification was carried out using PCR mixture-2 blue (AmpliSens, Russia) containing Taq-polymerase on a T100 Thermal Cycler (Bio-Rad, USA). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2% β-mercaptoethanol) and separated on a 10% gel by SDS-PAGE (TGX Stain-Free™ FastCast™ Acrylamide Solutions; BIORAD) or 4-15% gel (Mini-PROTEAN® TGX Stain-Free™ ...
-
bioRxiv - Genomics 2022Quote: ... Each sample was tested by PCR systems (threshold – 0,050) to the presence of SARS-CoV-2 using a CFX Connect Real-Time PCR System (BioRad, Hercules, California, USA). RT-PCR were implemented in 40 μl of final volumes ...
-
bioRxiv - Biochemistry 2021Quote: ... the reactant was mixed with the 2 × SDS-PAGE sample buffer containing 100 mM β-mercaptoethanol and run on 12% Mini-PROTEAN TGX Precast Gel (Bio-Rad) without a boiling step ...
-
bioRxiv - Microbiology 2021Quote: ... The amplified genomic DNA from the PPA strains was resolved using 2% agarose gel and visualized in the Gel DocTM XR+ documentation system (Bio-Rad, USA).
-
bioRxiv - Microbiology 2021Quote: ... aeruginosa isolates were separated in 2% agarose gel and visualized their banding patterns in the Gel DocTM XR+ documentation system (Bio-Rad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then loaded onto 4-15% Criterion™ TGX™ Precast Midi Protein Gels (12 + 2 wells, 45 μl) (Bio-Rad) and subjected to SDS-PAGE at 200 V for ~45 min in 10× Tris/Glycine/SDS running buffer (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were performed with 2 × Taq Master Mix (Vazyme, Nanjing, China) on a Bio-Rad Thermal Cycler (Bio-Rad, Hercules, CA, USA) using the following procedure ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were resolved using a 2% agarose tris-acetate-EDTA gel and a 177 bp band was visualized using the ChemiDoc™ imaging system (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... 100 ng plasmid DNA and 100 μL of electrocompetent mycobacteria were mixed and transferred to a 2 mm electroporation cuvette (Bio-Rad #1652082). Where necessary ...
-
bioRxiv - Neuroscience 2020Quote: ... and followed by incubation with HRP-conjugated secondary antibodies for 2 hours at room temperature: goat anti-rabbit IgG (BioRad, #170-6515) or goat antimouse IgG (BioRad ...
-
bioRxiv - Plant Biology 2020Quote: ... or 1 μl (for the rest) of a 1/2 dilution of the cDNA was added to a reaction containing 1X of SsoFast EvaGreen (Bio-Rad, USA), 0.5 μM Forward and Reverse primers (Table 2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 60 of High Capacity NeutrAvidin slurry (Thermo PI29204) were washed three times with 1 mL 2X RIPA/1mM EDTA buffer in 2-mL chromatography columns (Bio-Rad 7326008) attached to a vacuum manifold (Promega A7231) ...
-
bioRxiv - Cell Biology 2021Quote: ... Selected siRNAs were spotted onto a gridded MatTek dish (P35G-2-14-C-GRID) using a contact spotter (ChipWriter Pro-Bio-Rad Laboratories) resulting in a layout of 4 × 8 spots 40 ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 viral RNA loads were determined using Droplet Digital PCR (ddPCR) supermix for probes without dUTP (Bio-Rad Laboratories Ltd) and the QX200 Droplet Digital PCR System Workflow (Bio-Rad Laboratories Ltd) ...
-
bioRxiv - Neuroscience 2020Quote: Brain tissues were homogenized in lysis buffer and then combined with 2 x Laemelli buffer (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Protein samples were then separated on 7.5 to 12.5% v/v sodium dodecyl sulfate (SDS ...
-
bioRxiv - Developmental Biology 2021Quote: ... following by 25 cycles of preamplification using mix of 47 pairs for MTE primers, each at final 50nM concentration (Supplementary information, Supplementary Table 2) and SsoAdvanced™ PreAmp Supermix (Cat# 1725160, Bio-Rad). After amplification ...
-
bioRxiv - Plant Biology 2021Quote: ... The pelleted nuclei were re-suspended in 200 µl of NIB and mixed with a 140 µl aliquot of melted 2% LMA agarose (Bio-Rad, 1703594) at 43°C ...
-
bioRxiv - Microbiology 2020Quote: ... Non-human primate samples were inactivated with γ-radiation (2 MRad) according to standard operating procedures and assayed on a Bio-Plex 200 instrument (Bio-Rad) using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were resuspended in MACS buffer (PBS +2% FBS +2mM EDTA) and counted using trypan blue with the TC20™ Automated Cell Counter (Bio-Rad). In some cases ...
-
bioRxiv - Plant Biology 2020Quote: ... Incubate 1 μL of reticulocyte extract before binding with beads and 2 μL of extract after the binding was used for each western on a precast gel (4–20% Criterion™ TGX™ Precast Midi Protein Gel, 12+2 well, 45 μl, BioRad). Before loading ...
-
bioRxiv - Microbiology 2020Quote: Serum samples were inactivated with γ-irradiation (2 mRad) and cytokine concentrations were determined on a Bio-Plex 200 instrument (Bio-Rad) using Milliplex Mouse Cytokine/Chemokine MAGNETIC BEAD Premixed 25 Plex Kit (Millipore) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 10 μL of reconstituted representative influenza vaccine (i.e., AddaVax/Y-2) of Fluad Quadrivalent was mixed with Laemmli Sample Buffer (Bio-Rad, Hercules, CA) and β-mercaptoethanol (2% ...
-
bioRxiv - Neuroscience 2020Quote: ... brain tissues were homogenized in lysis buffer and then combined with 2 x Laemelli buffer (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Protein samples were then separated on 7.5 to 12.5% v/v sodium dodecyl sulfate (SDS ...
-
bioRxiv - Cancer Biology 2021Quote: ... according to the manufacturer’s instructions in a MyiQ™2 Two-Color Real-Time PCR Detection System (Bio-Rad, Veenendaal, The Netherlands).
-
bioRxiv - Cell Biology 2021Quote: ... 1∼2 μg of total protein for each lane) was loaded on a precast 4-20% gradient polyacrylamide gel (PAGE, Bio-Rad: 4561096) and electrophoresed at a constant voltage of 200 V for 35 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were detected by incubation with HRP-conjugated secondary antibodies for 2 hours at room temperature: goat anti-rabbit IgG (BioRad, #170-6515) or goat anti-mouse IgG (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were visualized with goat anti-mouse or goat anti-rabbit IgG secondary antibodies (1:5000) diluted in 2% Omniblot milk (AmericanBio) in 1X TBST using a chemiluminescence detection system (BioRad ChemiDoc MP).
-
bioRxiv - Microbiology 2022Quote: We finalized the IPATS-BLV reaction in a 22-μl reaction mixture containing 14 μl of 2× ddPCR Supermix for Probes (Bio-Rad, #1863023), 909 nM of primers except the RPP30 primers (DRB3*016:01-forward ...
-
bioRxiv - Immunology 2022Quote: ... To each well 50 µL of 2 µg/mL of biotin-conjugated mouse anti-bovine IFN-γ mAb (CC302, Bio-Rad Antibodies) diluted in PBS was added and plates incubated for 2 hours at RT ...
-
bioRxiv - Microbiology 2022Quote: ... 100 ng plasmid DNA and 100 μL of electrocompetent mycobacteria were mixed and transferred to a 2 mm electroporation cuvette (Bio-Rad #1652082). Where necessary ...
-
bioRxiv - Microbiology 2022Quote: ... the fluorescence of the EvaGreen dye incorporated into the PCR product was measured at the end of each cycle using SoFast EvaGreen Supermix 2× kit (Bio-Rad, France). A standard curve using gDNA of purified viruses was performed in parallel of each experiment ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were centrifuged for 2 min at 12,000 x g before being separated on 8–16% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad) at 160 V for 60 min ...