Labshake search
Citations for Bio-Rad :
1151 - 1200 of 4293 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2E3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Greater than 90% of purity of monocytes was achieved as determined by flow cytometry using a mouse anti-bovine CD14 FITC-labelled antibody (BioRad).
-
bioRxiv - Bioengineering 2022Quote: ... Cells were washed with 1% w/v milk in PBS prior to addition of a secondary goat anti-mouse alkaline phosphatase (ALP) conjugated antibody (STAR117A, BioRad) at 1:1000 dilution in 1% w/v milk in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... We utilized colorimetric detection to visualize the MBP-Vpu band(s) on the membrane after WB transfer: Primary mouse anti-histidine tag antibody (BioRad) and secondary goat anti-mouse IgG antibody conjugated to Alkaline Phosphatase (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were rinsed 3x for 15 minutes in 1X TBST and incubated in the proper secondary antibody (Goat anti-mouse BioRad #170-6516 or Goat anti-rabbit BioRad #170-6515 ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed three times before the addition of HRP-conjugated anti-mouse IgG (H+L; Bio-Rad; 170-6516) at 1:3,000 and anti-mouse IgG2b (ab97250 ...
-
bioRxiv - Microbiology 2023Quote: ... The proteins were visualized using the secondary antibody Anti-Mouse IgG-HRP using Clarity Max™ Western ECL Substrate (BioRAD).
-
bioRxiv - Immunology 2024Quote: ... Lysates were then cleared by centrifugation for 15 minutes at 14,000 rpm at 4°C and subjected to immunoprecipitation with anti-V5 mouse monoclonal antibody (#MCA1360, Bio-Rad) overnight at 4°C with rotation in DNA/RNA LoBind tubes ...
-
bioRxiv - Immunology 2019Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...
-
bioRxiv - Immunology 2020Quote: ... and mouse serum (BioRad). Blocking and subsequent surface staining was performed using PBS containing 2 mM EDTA ...
-
bioRxiv - Immunology 2023Quote: ... Mouse (Biorad, 10025637, qMmuCED0044924).
-
bioRxiv - Cell Biology 2023Quote: ... WIPI2 (BioRad, MCA5780GA, mouse), AMBRA1 (Santa Cruz Biotechnologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Secondary α-mouse (BioRad) and α-rabbit (BioRad ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% FBS for 1 hour and incubated with anti TGN46 antibody (#AHP500GT, BioRad, 1:2000) at 4°C overnight ...
-
bioRxiv - Immunology 2022Quote: ... supernatants were diluted at 1:4 and measured by Bio-Plex Pro mouse IFN-γ immunoassay (Bio-Rad) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight with the following primary antibodies: αWIPI2 1:3000 (mouse, Bio-Rad, Hercules, CA, MCA5780GA), αWIPI4/WDR45 1:2000 (rabbit ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Mouse plasma was analysed using the mouse 23-plex cytokine panel (Bio-Rad) as specified by the manufacturer and contained the following targets ...
-
bioRxiv - Biophysics 2019Quote: ... and horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G (IgG) antibody (catalog no. 1721011, batch no. 64109318) were all purchased from Bio-Rad Laboratories (Hercules ...
-
bioRxiv - Microbiology 2020Quote: ... Excess antibody was washed away with 3 x TBST rinses before the membrane was incubated with anti-mouse secondary antibody (Bio-rad) conjugated to horseradish peroxidase at a 1:15000 dilution in TBST at 25°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... CD11b+ cells were used for flow cytometric analysis after cells were stained with Alexa647-conjugated rat anti-mouse CD204 antibody (clone 2F8; Bio-Rad Laboratories GmbH ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed thrice before the addition of horseradish peroxidase (HRP)-conjugated anti-mouse IgG (H+L) (Bio-rad, 170-6516) at 1:3,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... were used for Western blotting together with anti-mouse IgG antibody conjugated with horseradish peroxidase (goat-polyclonal, 5178-2504, Bio-Rad). Chemicals were purchased from Sigma-Aldrich unless specified otherwise.
-
bioRxiv - Pathology 2020Quote: ... The sections were rinsed in PBS three times and incubated with Alexa Fluor 488- or Alexa Fluor 594-labelled goat anti-mouse (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2020Quote: ... for 1hr at RT and probed with HRP-conjugated anti-rabbit or mouse IgG antibodies and detected with ChemiDoc XRS+ imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2020Quote: ... Blots were washed 3x for 5 min each in TBS without Tween and incubated with goat anti-mouse IgG coupled to horseradish peroxidase (BioRad, #170656) at a 1:3000 dilution in blocking buffer for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 50 µL/well of 2 µg/mL of mouse anti-bovine IFN-γ mAb (CC330 Bio-Rad Antibodies) diluted in carbonate coating buffer (pH 9.6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... blots were washed three times in TBST for 5 minutes each and incubated with an anti-mouse HRP secondary (Bio-Rad) at 1:2000 dilution for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Bovine CD4+ T cells were isolated from PBMCs by magnetic-activated cell sorting (MACS) using a mouse anti-bovine CD4 antibody (clone CC8, Bio-Rad), anti-mouse IgG MicroBeads (Miltenyi Biotec) ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-rabbit IgG (H + L) secondary antibody and goat peroxidase-conjugated anti-mouse IgG (H + L) secondary antibody were purchased from Bio-Rad.
-
bioRxiv - Immunology 2023Quote: ... and 100 μL of the secondary antibody solution - Goat Anti-Mouse IgG (H+L)-HRP Conjugate (Bio-Rad, Hercules, CA, USA) diluted in a 1:2,000 ratio in the antibody diluent - was then added and the plates were incubated for 1 hour in the dark at RT ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed thrice before addition of horseradish peroxidase (HRP)-conjugated anti-mouse IgG (170-6516; Bio-rad, Hercules, California, USA), anti-mouse IgG1 (ab97240 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Samples were then incubated at RT for 1 hr in primary anti-tubulin antibody (Bio-Rad, 1:200) in PBS-BSA (5 mM potassium phosphate ...
-
bioRxiv - Neuroscience 2019Quote: ... goat anti-rat (1:1000; Alexa Fluor 568, #A11077) and V5-tag:AlexaFluor-647 (1:200; Bio-Rad MCA1360A647).
-
bioRxiv - Microbiology 2019Quote: ... and BB2-epitope tag (1:4,000) followed by HRP-conjugated goat anti-rabbit antibody (1:4,000; Bio-Rad). Membrane blocking ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti- Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Microbiology 2019Quote: ... both with peroxidase-conjugated anti-rabbit secondary antibody (Bio-Rad, 1:10,000).
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated goat anti-rabbit IgG (1:2000, Bio-Rad, 170-6515) and goat anti-mouse IgG (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... in addition to rhodamine anti-β-actin (1:5,000, Bio-Rad, 12004163) for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG conjugated to horseradish peroxidase (Bio-Rad, 1:5,000 dilution) was used as secondary antibody ...
-
bioRxiv - Immunology 2022Quote: ... hFAB Rhodamine anti-GAPDH primary antibody (Bio-Rad, cat. 12004168, 1:10,000).
-
bioRxiv - Microbiology 2022Quote: ... Goat Anti-Rabbit IgG HRP Conjugate (1:25,000 dilution, Bio-Rad; 1706515). Membranes were visualized using the Bio-Rad ChemidDoc MP Gel Imager.
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-Myelin Basic Protein (BIO-RAD, reference MCA409S, 1/1000 dilution), rabbit anti-β-Tubulin III (Tuj1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Anti-tubulin hFAB Rhodamine (12004166, 1:3000 dilution) was from Bio-rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... probed with goat-anti rabbit HRP conjugate antibody (1:3000) (Bio-Rad) in TBST/5% wt/vol non-fat milk (1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-CD68 (1:2,000, Bio-Rad, Hercules, CA; catalog no. MCA1957), rat anti-Lamp1 (1:4,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Following primary antibodies were used: anti-CD68 (rat 1:600, BioRad, MCA1957T), anti-Galactin1 (rabbit 1:200 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and anti-rabbit HRP conjugate (Bio-Rad; 170-6515; 1:3,000 dilution).