Labshake search
Citations for Bio-Rad :
1051 - 1100 of 9457 citations for Recombinant Human IFNGR1 Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The protein concentration was measured using the Bradford method (protein assay kit, Bio-Rad) and adjusted by adding 20 mM HEPES buffer (pH 7.4).
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentrations were determined using the Protein Assay Dye Reagent Concentrate (Bio-Rad, 5000006). Thirty micrograms of each protein sample were separated by SDS-PAGE and transferred onto a nitrocellulose membrane using the Transblot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... the protein concentration was measured using Protein Assay Dye Reagent Concentrate (Bio-Rad, 5000006) and all samples were adjusted to the lowest value ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations were measured using the DC Protein Assay (Bio-Rad, Cat no. 5000112) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration was quantified using a BioRad DC Protein Assay (Bio-Rad, 500-0116). Whole-cell lysates were separated by either 12.5% or 4-12% SDS-PAGE Bis-Tris gels (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Protein samples were quantified using the BCA protein assay method (Bio-Rad, Victoria, Australia), and 10 μg (unless specified otherwise ...
-
bioRxiv - Cell Biology 2020Quote: ... Precision Plus Protein Standards (BioRad) were used in every gel as molecular weight standards ...
-
bioRxiv - Cell Biology 2022Quote: ... using Protein Assay Dye (BioRad). 20 μg protein from each sample was separated on 6% or 8% gels by SDS-PAGE and subsequently transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2020Quote: ... Protein quantification by Bio-Rad protein assay was carried out on the same lysates to normalize the B-gal data for protein content.
-
bioRxiv - Neuroscience 2021Quote: ... detergent compatible protein assays (Biorad) were carried out in duplicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... DC protein assay (Bio-Rad) was used to quantify the protein concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... Precision Plus Protein Standard (BioRad) was run as molecular weight marker ...
-
bioRxiv - Microbiology 2022Quote: ... Bradford protein assay (Bio-Rad) was used to determine protein concentration ...
-
bioRxiv - Physiology 2020Quote: ... A Biorad protein assay (Biorad) was used to quantify the protein and Coomassie protein stain (InstantBlue™ Protein Stain Instant Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bradford protein assay (BioRad) was used to compare protein concentrations across samples.
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay (Bio-Rad) was employed to quantify proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope (BioRad) was used as a molecular weight standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured by Bio-Rad protein assay (#5000006, Bio-Rad) and equal volume and quantity of protein samples were made by addition of 4x Laemmli Sample Buffer (#1610747 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A protein transfer apparatus (BioRad) was used for transferring proteins to a Sequi-Blot PVDF membrane (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein standards from Bio-Rad were used to interprete elution profiles ...
-
bioRxiv - Cell Biology 2021Quote: ... Cholesterol concentrations were normalized by the protein concentration determined by Bio-Rad Protein Assay Dye (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was then incubated with HRP-conjugated anti-His monoclonal antibody (1:5000) and detected with supersignalfemto substrate (Thermoscientific, USA) using ChemiDoc imaging system (Bio-Rad laboratories, USA).
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).