Labshake search
Citations for Bio-Rad :
1051 - 1100 of 1550 citations for 7 Benzothiazolecarboxylicacid 2 3 dihydro 2 thioxo methylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in total 24ul volume using 12ul of 2 x ddPCR Supermix for Probes (No dUTP) (Bio-Rad Laboratories, catalog no. 1863024), 900nM of target primer pairs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg of total RNA was reverse-transcribed to single-stranded complementary DNA (cDNA) using iScript cDNA Synthesis Kit (Bio-Rad Hercules, CA, USA). RT-qPCR was run on Lightcycler 480 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... We mixed 10 μL of each fraction with 2 μL of denaturing RNA loading dye and loaded it into a 1.0 cm well PAGE casting plate (Bio-Rad Laboratories, Mississauga, ON, Canada). Urea-PAGE (7.5% ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... DNA was diluted to 10 ng/μl and 2 μl were used in each RT-qPCR reaction with 10 μl of iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) and 400 nM of forward and reverse primers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μg of dsDNA were added to the competent cells and then transferred to chilled 2 mm gap electroporation cuvettes (Bio-Rad Laboratories GmbH, Germany). Electroporation transformation was done with a single pulse at 1.8 kV ...
-
bioRxiv - Developmental Biology 2023Quote: ... under reducing conditions using 2-ME and transferred onto polyvinylidene difluoride (PVDF) membrane using the Trans Blot Turbo system (Bio-Rad, Hercules, CA, USA). After blocking with 10% skim milk (Becton Dickinson ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Microbiology 2021Quote: ... and final extension at 72°C for 7 min using a C1000 Touch Thermal Cycle (BIO-RAD). PCR results were run on 1% agarose gels and imaged using an iBright CL1500 Imaging system (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... for 7 minutes and separated with 4-20% Mini-PROTEAN TGX protein Gel (Bio-Rad, Cat # 5671094), transferred to nitrocellulose membranes according to standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The WB samples were loaded on a 4-20% or 7% Midi CriterionTM TGXTM Precast gel (BioRad) and ran at 180V for 45min in 1x running buffer (190mM glycine ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and heated at 95°C for 7 min prior to separation by 10% SDS-PAGE (BioRad Laboratories). Following electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were electrophoresed in a Bio-Rad Criterion TM Vertical Electrophoresis Cell at 90-120V for 1-2 hours and then transferred to a PVDF Transfer Membrane (#88518, Bio-Rad, Hercules, CA, United States) using the Bio-Rad Trans-Blot Turbo Transfer System ...
-
bioRxiv - Microbiology 2020Quote: Cell lysates in 1X RIPA buffer were mixed with an equal volume of 2X Laemmli sample buffer (Bio-RAD, containing 50 µl/ml 2-mercaptoethanol) followed by boiling for 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... the Agrobacterium-infiltrated leaves were visually inspected at 2-5 days post infiltration and/or the fluorescence of the infiltrated leaves were monitored at 1-2 d post infiltration under the Pro-Q Emerald 488 in the ChemiDoc™ Gel Imaging System (Bio-Rad, Hercules, CA, USA) as described previously (Yoon and Rikkerink 2020).
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were incubated for 2 h at room temperature in HRP conjugated IgG anti-rabbit secondary antibody (Bio-Rad 170-65-15, 1:3000) or Cy5 conjugated IgG anti-mouse secondary antibody (Jackson ImmunoResearch Laboratories Europe Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed using 2 × T5 Fast qPCR Mix (SYBR Green I) with a Bio-Rad CFX Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: The pure cultures were grown in TSAYE plates for 24 h and DNA was extracted using 2% Chelex solution (Chelex 100 resin, Bio-Rad laboratory, Hercules, California, USA). The colonies (2-3 mm ...
-
bioRxiv - Microbiology 2020Quote: ... in oral swabs of positive and negative subjects for SARS-CoV-2 using magnetic bead-based multiplex immunoassays (Bio-Plex Pro™ human cytokine 27-plex panel, Bio-Rad Laboratories, Milan, Italy) according to the pre-optimized protocol 15 ...
-
bioRxiv - Genetics 2020Quote: ... and ligated to MseI and EcoRI adaptors (Supplementary Table 4) at 37° C for 2 h in a T100™ Thermal cycler (Bio-Rad Laboratories, Hercules, CA). Success of the digestion/ligation reaction was confirmed on 1.5% of agarose gel electrophoresis ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative PCR was performed in triplicate and the 2−ΔCt method was used to calculate the expression of RUNX3 relative to β-actin (ID Assay qHsaCED0036269, Bio-Rad Laboratories, Kidlington, UK).
-
bioRxiv - Microbiology 2019Quote: ... for 5 min in 2 ml screw-cap vials with 2 g of glass beads (2mm) and 200 μl of buffer containing 1 × TE buffer and Chelex®-100 (Bio-Rad Laboratories, CA, USA). Samples were then incubated overnight at 56 °C with 10 μl of Proteinase K (20mg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... and EV/HSP27 mixtures containing 2 µg of HSP27 at the indicated w/w ratios were mixed with native sample buffer (cat#1610738, Bio-Rad Laboratories Inc., Hercules, CA) and loaded into the gel lanes ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were blocked in serum and then incubated in primary antibody for 2 hr at RT (CD-68: 1:500, Bio-Rad clone FA-11, MCA1957GA), and then processed for secondary and HRP reagent using a Vectastain ABC kit according to the manufacturer’s instructions (Rat IgG ...
-
bioRxiv - Biochemistry 2023Quote: ... The eluate was incubated for 60 min at room temperature with 50 mg of prewashed SM-2 Bio-Beads (Bio-Rad Laboratories, Hercules, CA, USA) under overhead rotation to ensure detergent removal.
-
bioRxiv - Immunology 2023Quote: ... was performed using 2×RealStar Green Fast Mixture (GenStar, Beijing, China) in a CFX384 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA). The relative transcription levels of the genes of interest were normalized against the expression of GAPDH and calculated using the ΔΔCT method ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were run in a 2% agarose slab gel and stained with ethidium bromide for visualization by UV shadowing (Bio-Rad Molecular Imager Gel Doc XR+).
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Cell Biology 2020Quote: ... and the slices were transfected at 4 – 7 days in vitro using a Helios gene gun (Bio-Rad). Slices were examined at 1 – 2 weeks post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...