Labshake search
Citations for Bio-Rad :
1001 - 1050 of 10000+ citations for Retinol Binding Protein RBP Multi format ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 lane was kept for molecular weight markers (Precision Plus Dual Color Protein Standard, Bio-Rad). Samples after electrophoresis were transferred to PVDF membranes (Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration in each lysate sample was quantified with Quick Start Bradford 1× Dye (BioRad) to equalise protein concentrations across the samples before SDS-PAGE and immunoblotting.
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were probed with either secondary antibodies goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR reactions and measurements were performed with a CFX384 Real-Time PCR detection system or an iQ5 Multi-color real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using the SYBR Green Fluorescein Mix (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Forty µg denatured protein per well was resolved by 8-12% SDS- PAGE homemade gels in parallel with multi-colored molecular weight marker (Bio-Rad Laboratories, Cat.No.1610395). Gels were run at 100V for 1-2 h and transferred overnight at 8- 12V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The detection of the proteins on the membrane was performed using the Clarity Western ECL Substrate kit (Bio-rad). The signals were captured using the Alliance Mini (UVITEC Cambridge ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysates were cleared by centrifugation at 20.000g for 10min and quantified with the DC Protein assay Kit (Bio-Rad). 25 µg of the lysates were then separated on NuPAGE 4-12% Bis-Tris gels (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate was spun down at 14000 rpm and protein concentration was determined using the Bradford assay as detailed in the manufacturer’s kit (Biorad). Samples were denatured with SDS and methylene blue ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were blotted onto a nitrocellulose membrane using the Trans-Blot Turbo TRA Transfer Kit (Bio-Rad, Feldkirchen, Germany). Following protein transfer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Immunoblot was performed by transferring protein to a PVDF membrane using Trans-Blot Turbo RTA Transfer Kit (Biorad, 1704272) and the Biorad Transblot Turbo System ...
-
bioRxiv - Molecular Biology 2023Quote: ... the concentration was calculated by the Bradford assay using a Quick Start Bradford Protein Assay Kit 2 (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: Fractionation of nuclear and cytoplasmic fractions from Drosophila lysates was conducted with the ReadyPrep Protein Extraction Kit (Bio-Rad). Seven whole flies per group were homogenized in cytoplasmic extraction buffer (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... The protein bands were visualized using an ECL kit (Meilunbio, CHN) and imaged on ChemiDoc XRS+ (Bio-Rad, USA).
-
bioRxiv - Cell Biology 2024Quote: ... proteins were transferred onto membranes using Trans-Blot® TurboTM RTA Midi 0.2 µm Nitrocellulose Transfer Kit (Biorad, #1704271). The membranes were subsequently blocked in TBST solution (200 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were separated by 10% SDS polyacrylamide gel electrophoresis (SDS-PAGE) using a Mini-PROTEAN kit (1658001FC, Bio-Rad). Between 20 and 50 μg of protein per well were loaded ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: Steady-state equilibrium binding of post-vaccination rabbit polyclonal serum was monitored at 25°C using a ProteOn surface plasmon resonance (BioRad). The purified recombinant Spike proteins were captured to a Ni-NTA sensor chip with 200 resonance units (RU ...
-
bioRxiv - Pathology 2020Quote: ... Antibody binding was detected with electrochemiluminescence substrate (#12757P; CST) and chemiluminescence visualized with ChemiDoc™MP Gel Imaging System (BioRad).
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: Steady-state equilibrium binding of hCoV-2IG lots was monitored at 25°C using a ProteOn surface plasmon resonance (BioRad). The purified recombinant SARS-CoV-2 RBD proteins were captured to a Ni-NTA sensor chip with 200 resonance units (RU ...
-
bioRxiv - Genetics 2023Quote: ... Differential binding was assessed by densitometry analysis of photostimulated luminescence (PSL) using Molecular Imager PharosFX System (Bio-Rad, #170-9450) and Quantity One 1-D analysis software (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and protein concentrations were calculated using a BCA protein assay (BioRad). After denaturation with Laemmli buffer (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein amounts were quantified using Biorad Protein Assay (Biorad #500-0006) and a bovine serum albumin standard curve (Biorad #500-0007 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein content was quantified by the DC protein assay (Bio-Rad) with known concentrations of BSA as standards ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were determined using the DC Protein Assay (BioRad 5000111) and 20 µg total protein was denatured for 5 min at 70°C in 1X Laemmli Buffer (Sigma Cat # S3401-10VL) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined by the Bradford Protein Assay (Bio-Rad). Western blots were carried out using secondary antibody (Immunopure goat anti-mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined by the Bradford protein assay (Bio-Rad) or bicinchoninic acid (BCA ...
-
bioRxiv - Developmental Biology 2020Quote: ... After measuring the protein concentration with DC protein Assay (Bio-Rad), 25 μg of total protein was loaded into the well on ELISA plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated on 4-15 % precast protein gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein content was determined using DC Protein Assay (5000112, Biorad) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Equal amounts of supernatant proteins (determined by Bio-Rad protein assay) were fractionated by SDS-PAGE and analyzed by immunoblotting.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein quantification was performed using the DC Protein assay (Bio-Rad). 40μg of protein was run on NuPAGE 4-12% Bis-Tris protein gel (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein content was quantified using the DC Protein Assay (BioRad #5000111). Samples were boiled and reduced in a mixture containing NuPAGE® Sample Reducing Agent (10X ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sample protein concentration was determined by Bradford Protein Assay (Bio-Rad) and A595 readings were measured in a DU 730 UV-Vis Spectrophotometer (Beckman Coulter) ...
-
bioRxiv - Microbiology 2019Quote: ... Protein concentration was determined using RC DC Protein Assay (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were quantified using the DC Protein Assay (Bio-Rad), following manufacturer’s protocols ...
-
bioRxiv - Pathology 2021Quote: ... Protein concentration was measured by DC protein assay (BioRad, 500-0112), and 5 mM β-mercaptoethanol was added to the samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration was measured using Protein Assay Dye (BioRad #500-0006) in comparison to a BSA (NEB B9000S ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were determined by Bradford protein assay (#5000006, Bio-Rad). Relative protein contents in the muscles were calculated after normalizing by total amount of DNA.
-
bioRxiv - Pathology 2021Quote: ... Protein concentration was determined by a DC Lowry protein assay (BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... and protein quantified using the DC protein assay (Bio-Rad: 5000111). Derived metabolite data was normalized to protein concentration and median ion intensity per injection across the dataset.
-
bioRxiv - Cancer Biology 2020Quote: ... and protein concentration determined using Protein Assay Dye (BioRad 500-0006) against a bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration was determined with the DC protein assay (Bio-Rad) according to manufactures manual ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein extracts were quantified using RC-DCTM Protein Assay (Bio-Rad). Three biological replicates from Vglut2:Ndufs4cCT and Vglut2:Ndufs4cKO mice mitochondria were processed ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentration was determined by DC™ protein assay (Bio-Rad). About 1 mL of lysate with similar protein concentration was added to tubes with 50 μL of anti-FLAG magnetic beads (Sigma ...
-
bioRxiv - Genomics 2020Quote: ... Protein concentration was determined by Bradford protein assay (Biorad, Hercules, CA), according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Protein concentration was assessed (Quick Start Bradford Protein Assay, Bio-Rad) and samples were normalized to ~10 - 25 mg protein/mL ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were quantified by RC DC™ protein assay (Bio-Rad) and a control of the protein pattern of all the extracts was performed by SDS-PAGE and silver staining ...
-
bioRxiv - Microbiology 2020Quote: ... and proteins separated on 4–20% Mini-Protein TGX gels (Biorad). Proteins were transferred to PVDF membranes (Bio-Rad ...