Labshake search
Citations for Bio-Rad :
1001 - 1050 of 9412 citations for Recombinant Human UBE2G2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... A Biorad protein assay (Biorad) was used to quantify the protein and Coomassie protein stain (InstantBlue™ Protein Stain Instant Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bradford protein assay (BioRad) was used to compare protein concentrations across samples.
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay (Bio-Rad) was employed to quantify proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope (BioRad) was used as a molecular weight standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured by Bio-Rad protein assay (#5000006, Bio-Rad) and equal volume and quantity of protein samples were made by addition of 4x Laemmli Sample Buffer (#1610747 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A protein transfer apparatus (BioRad) was used for transferring proteins to a Sequi-Blot PVDF membrane (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein standards from Bio-Rad were used to interprete elution profiles ...
-
bioRxiv - Cell Biology 2021Quote: ... Cholesterol concentrations were normalized by the protein concentration determined by Bio-Rad Protein Assay Dye (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatants were collected and protein concentration was calculated by Bradford Protein Assay (Bio-rad). The denatured lysates were electrophoresed on SDS-PAGE gels and transferred to polyvinylidene fluoride membranes (BioExpress) ...
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration in the supernatant was determined using DC protein assays (Bio-rad, 5000116) with bovine serum albumin solutions as standards ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein concentration was measured with an RC DC protein assay kit (Bio-Rad; Feldkirchen, Germany). 10 μg protein per sample was loaded ...
-
bioRxiv - Physiology 2022Quote: ... Samples were loaded alongside 10 µL protein ladder (Precision Plus Protein Standards Kaleidoscope ladder, BioRad). Self-cast gels (Mini-PROTEAN ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysate protein concentration was determined using DC Protein Assay Kit II (cat# 5000112, Bio-Rad). Equivalent amounts of protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration of VSW-3 RNAP was determined by Bradford protein quantitative kit (Bio-rad), and protein purity and concentration were analyzed along with T7 RNAP (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration in each fraction of soluble proteins was determined by Bradford assay (Bio-Rad). Specific ß-galactosidase activities in the same fractions were measured according to Miller (51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration of the clarified lysate was measured using DC™ Protein Assay (Bio-Rad). Protein levels of wild-type or mutant Rad6 were determined by immunoblotting using anti-Flag M2 antibody (Sigma).
-
bioRxiv - Cancer Biology 2019Quote: ... Total protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). Nuclear extracts containing the total of 40 µg protein were separated on a 10% Tris-SDS PAGE gel (Bio-Rad Mini-PROTEAN® TGX) ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein concentrations of the supernatants were determined with Bradford protein assay (Bio-rad, Hercules, CA). Supernatants were mixed with 4x β-mercaptoethanol Laemmli sample buffer to a final 25 μg protein/sample ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad).
-
bioRxiv - Neuroscience 2019Quote: ... The protein concentration was measured using the BCA protein assay according to manufacturer’s instruction (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Neuroscience 2020Quote: ... All fractions were assayed for protein content (Bio-Rad Protein Assay; Bio-Rad, Hercules, CA) and frozen at −80°C until further use ...
-
bioRxiv - Molecular Biology 2019Quote: ... Protein concentration was measured using the Bradford protein assay following the manufacturer’s instructions (Bio-Rad). The samples were mixed with 6X loading buffer (240 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total protein concentration was determined by DC™ Protein Assay (Bio-Rad, Hercules, CA, USA). All the samples were kept at −70°C until they were used for analysis.
-
bioRxiv - Genetics 2021Quote: ... The protein content of the lysate was determined using Bio-Rad Protein Assay (Bio-Rad) on a spectrophotometer ...