Labshake search
Citations for Bio-Rad :
1001 - 1050 of 8851 citations for Recombinant Human PRL Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was measured using the Bio-Rad protein assay (Bio-Rad, Munich, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... Protein concentration was measured by chemioluminescence using RC DC™ Protein Assay (Bio-Rad). Forty micrograms of protein samples were denatured in reducing loading buffer containing β-mercaptoethanol (M3148 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration of the supernatant was normalized using the DC protein assay (Bio-Rad). Whole cell lysates (200 µg ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein separation was performed using 12% Mini-PROTEAN® TGX Protein Gels (Bio-Rad) alongside PageRuler™ Prestained Protein Ladder (Thermo Fischer Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and protein concentrations were measured by the Bio-Rad DC protein assay (Bio-Rad, Reagent A ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total protein for each sample was determined using the DC Protein Assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration of the lysate was determined by DC protein concentration assay (Bio-Rad) followed by absorbance measurements using a CLARIOstar microplate reader (BMG LABTECH) ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein concentration in this lysate was estimated using the DC protein assay (BioRad) and used to normalize ATP and lactate values.
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentration of each sample was measured using the DC Protein Assay (Bio-Rad) following manufacturer instructions using BSA as a standard (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein samples were normalized (Bio-Rad Protein Assay, 5000001, Bio-Rad, CA, USA) and 30 µg were loaded into a 7.5 to 12% sodium dodecyl sulfate (SDS)-polyacrylamide gel for electrophoresis ...
-
bioRxiv - Cell Biology 2024Quote: Protein concentrations were quantified using the detergent-compatible (DC) protein assay (Bio-Rad, 5000112) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration of the supernatants were quantified by Bradford protein assay (Bio-Rad, 5000006). 30 µg of protein samples were used for immunoblotting with nitrocellulose membranes (Amersham Protran ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Cell Biology 2020Quote: ... Precision Plus Protein Standards (BioRad) were used in every gel as molecular weight standards ...
-
bioRxiv - Cell Biology 2022Quote: ... using Protein Assay Dye (BioRad). 20 μg protein from each sample was separated on 6% or 8% gels by SDS-PAGE and subsequently transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2020Quote: ... Protein quantification by Bio-Rad protein assay was carried out on the same lysates to normalize the B-gal data for protein content.
-
bioRxiv - Neuroscience 2021Quote: ... detergent compatible protein assays (Biorad) were carried out in duplicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... DC protein assay (Bio-Rad) was used to quantify the protein concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... Precision Plus Protein Standard (BioRad) was run as molecular weight marker ...
-
bioRxiv - Microbiology 2022Quote: ... Bradford protein assay (Bio-Rad) was used to determine protein concentration ...
-
bioRxiv - Physiology 2020Quote: ... A Biorad protein assay (Biorad) was used to quantify the protein and Coomassie protein stain (InstantBlue™ Protein Stain Instant Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bradford protein assay (BioRad) was used to compare protein concentrations across samples.
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay (Bio-Rad) was employed to quantify proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope (BioRad) was used as a molecular weight standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured by Bio-Rad protein assay (#5000006, Bio-Rad) and equal volume and quantity of protein samples were made by addition of 4x Laemmli Sample Buffer (#1610747 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A protein transfer apparatus (BioRad) was used for transferring proteins to a Sequi-Blot PVDF membrane (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein standards from Bio-Rad were used to interprete elution profiles ...
-
bioRxiv - Cell Biology 2021Quote: ... Cholesterol concentrations were normalized by the protein concentration determined by Bio-Rad Protein Assay Dye (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...