Labshake search
Citations for Bio-Rad :
1001 - 1050 of 2118 citations for Rabbit Anti Human IgG gamma chain Alexa Fluor 750 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Microbiology 2022Quote: ... then incubated for 1 hour at RT with 1:10,000 goat anti-rabbit horseradish peroxidase (HRP) (Bio-Rad, Cat# STAR208P). The membrane was washed 3 times for 5 minutes with TBST ...
-
bioRxiv - Cell Biology 2023Quote: ... The blot was visualized by incubating the membrane with an HRP-labelled anti-rabbit antibody followed by detection using ECL (Biorad) at the Chemidoc (Biorad).
-
bioRxiv - Molecular Biology 2023Quote: ... The following secondary antibodies and dilutions were used for 1 hour at room temperature: goat anti-rabbit StarBright Blue 700 (1:2,500; Bio-Rad), goat anti-rabbit IRDye 800 CW (1:5,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated with secondary antibody goat anti-rabbit conjugated to HRP (1:5000, 5% wt/vol milk in TBS-T; #170-6515, BioRad) for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were washed 3X in PBST (10 minutes) and incubated for 1 hour with horseradish peroxidase conjugated anti-rabbit secondary antibody (BioRad 170-6515 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HRP-conjugated secondary antibodies used were anti-rabbit and anti-mouse at a dilution of 1:2000 and immunoblots were developed using Chemidoc imaging system (ChemiDoc, BioRad).
-
bioRxiv - Immunology 2021Quote: ... both conjugated with Alexa Flour 647 (Bio-Rad, USA). HuCAL Fab-dHLX-MH Ab (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were acquired with a Fluor-S MAX MultiImager (Bio-Rad) and Quantity One software (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... or the same amount of IgG negative control antibody (Bio-Rad, MCA6004GA for MARCO and Invivogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies were goat α-mouse IgG-HRP (Biorad, 1706516; RRID:AB_11125547), goat α-mouse IgG2b-HRP (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were incubated with IgG HRP-conjugated secondary antibody (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... and secondary goat antimouse IgG antibody conjugated to Alkaline Phosphatase (BioRad) were used.
-
Systemic impact of the expression of the mitochondrial alternative oxidase on Drosophila developmentbioRxiv - Biochemistry 2022Quote: ... the membranes were incubated with a 1% nonfat milk/PBST solution containing the secondary HRP-conjugated goat anti-rabbit (1:10,000, Bio-Rad, USA) and anti-mouse (1:10,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... secondary antibodies were incubated with the PVDF membrane for 1 hour at room temperature (Goat anti-rabbit antibody, BioRad, 1:3000). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... Membranes were incubated with HRP-conjugated secondary antibodies for both FLAG and GFP stainings (Rabbit anti-goat-HRP conjugate, #1721034, Bio-Rad) diluted at 1:5000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 2 h at room temperature and a HRP-conjugated goat anti-rabbit secondary antibody (Bio-Rad 1706515; 1:3000 dilution) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-PfADF1 (1:2000, (Wong et al, 2011)) and HRP-coupled goat anti-mouse or -rabbit secondary antibody (1:5000, STAR120P/STAR121P, Bio-Rad). sBlots were washed in PBST and detected using ECL reagent (Amersham ...
-
bioRxiv - Neuroscience 2020Quote: ... the membranes were further incubated in secondary antibody solutions (TBST with 5% Non-Fat Dry Skinned Milk and Horseradish Peroxidase conjugated secondary antibodies Goat Anti-Rabbit/Mouse, 1:10000, Bio-Rad) for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... Membranes were washed three times with T-TBS for 15 min and incubated with goat anti-rabbit HRP-conjugated secondary antibodies (Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... proteins were subjected to primary antibody recognition using an anti-P1 antibody raised in rabbit (Siré et al, 2008) and purified by Affi-Gel 15 immnunoaffinity chromatography (BIO-RAD) using the recombinant P1 protein as the ligand (used at a 1:1000 dilution) ...
-
bioRxiv - Neuroscience 2019Quote: ... and lysed then immunoprecipitated as described above using homemade rabbit anti-PGRN antibodies bound to Affi-Gel 15 (Bio-Rad Laboratories). Samples were then mixed and boiled 5 minutes with 10mM DTT followed by alkylation by treating samples with a final concentration of 28 mM iodoacetamide ...
-
bioRxiv - Biochemistry 2020Quote: ... the anti-rabbit secondary antibody was incubated for 1 h and chemiluminescence was measured using a ChemiDoc XRS+ imaging system (Bio-Rad) after development in chemiluminescence reagent (Westar Nova 2011 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates of WT OSC were incubated with 1μg of Rabbit anti-Piwi polyclonal antibody (18) and 30 μl Surebeads Protein A Magnetic beads (Bio-Rad, 1614013). Immunoprecipitation was performed at 4°C overnight ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... The membrane was incubated with anti-mouse or anti-rabbit HRP-conjugated secondary antibodies in 5% milk and bands were developed with Chemi-Doc XRS imaging (Bio-Rad). The primary antibodies used are listed in Supplementary Table 3.
-
bioRxiv - Microbiology 2022Quote: ... Membrane was washed for 5 min 3x with TBS-T and incubated with secondary goat anti-rabbit-HRP antibody (Bio-Rad) at a 1:10000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the membranes were incubated with anti-mouse or –rabbit secondary antibodies tagged with horseradish peroxidase (1/10 000, Bio-Rad Laboratories) for one hour at room temperature and visualized by chemiluminescence (Amersham ECL prime western blotting detection reagent ...
-
bioRxiv - Microbiology 2023Quote: ... Signal detection was conducted with a goat anti-rabbit-HRP secondary antibody followed by development with Clarity ECL Substrate (Bio-Rad). Blots were imaged on Chemidoc XRS Imaging System (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... Blotted bands were detected using HRP conjugated secondary antibodies goat anti-rabbit conjugated with HRP (#1706515, Bio-Rad, 1:15, 000). ImageJ was used to calculate the fluorescence density of each band ...
-
bioRxiv - Physiology 2024Quote: ... was used to wash the membranes before incubating with goat anti-rabbit horseradish peroxidase conjugated secondary antibody at 1:5000 dilution (1706515, Bio-Rad) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... For detection, we used an anti-rabbit HRP-coupled secondary antibody (1:5000, Cell Signalling) and Western ECL substrate (#1705061, Bio-Rad. As a loading control ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP-conjugated secondary anti-mouse antibody (Amersham; NA931S) and anti-rabbit antibody (Amersham; NA934VS) at 1:10,000 and Clarity western ECL substrate detection kit (Bio-Rad; 170-5060) were used to detect the signals ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked in 10% normal donkey serum, and then stained in antibodies overnight (rabbit anti-Iba1, 1:500, Wako and CD68 (Biorad 1:100)) ...
-
bioRxiv - Immunology 2021Quote: ... in 0.1% BSA in 0.1% TBST and subsequently imaged using HRP-conjugated anti-rabbit antibodies (Bio-Rad Cat#172-1019, 1:10000) and Western Lightning Plus-ECL (PerkinElmer Cat#El103001EA ...
-
bioRxiv - Plant Biology 2021Quote: ... The membrane was first probed with the indicated primary antibodies and then incubated with goat anti-rabbit (Bio-Rad, cat. no. 1706515) or goat anti-mouse (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were washed three times in TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit (Bio-Rad 1,706,515, 1:10,000) secondary antibodies for 2 h at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% dry non-fat milk in PBST and probed using PRP8a antibody (1:500) and an HRP coupled anti-Rabbit secondary antibody (Biorad, 1:10000). All antibodies were diluted in 1% dry nonfat milk in PBST ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... blots were washed three times with 1X TBST and probed with the appropriate anti-rabbit (Cat# 170-6515, Bio-Rad, Hercules, CA) or anti-mouse (Cat# 7076 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membrane was visualised by chemiluminescence on Biorad ChemiDoc MP Imager after incubation with goat anti rabbit HRP conjugate (Biorad; 170-6515) or goat anti-mouse-HRP conjugate (Biorad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The blocking buffer was removed and 10 ml 5% BSA-PBST with 1 μl RABBIT anti-DYKDDDDK Tag antibody (Bio-Rad, # AHP1074), 1 μl anti-MBP Monoclonal Antibody (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... Western blot images were acquired with Fluor-S Max Scanner (Bio-Rad) by scanning membranes for 320 sec with 40 sec intervals ...