Labshake search
Citations for Bio-Rad :
1001 - 1050 of 9902 citations for Dengue Virus Serotype 3 DIII envelope protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Protein concentration was determined by Bradford Protein assay (Bio-Rad, Marnes-La-Coquette, France).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Protein concentration was quantified by measuring OD595 in a Bradford Protein Assay (BioRad, #5000006) relative to bovine serum albumin standards ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations were determined using a Bradford protein assay kit (Bio-rad, catalog #5000205), and 20 μg of protein was loaded into each lane of a 10-well SDS-PAGE gel ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein quantification by Bradford was carried out using DCTM Protein Assay Kit I (BioRad) on a Jenway Genova DNA Life Science Analyzer ...
-
bioRxiv - Developmental Biology 2024Quote: Protein concentration was determined with a BCA protein assay (Bio-Rad, Hemel Hempstead, UK). Proteins were then separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... Precision Plus Protein Standards (BioRad) were used in every gel as molecular weight standards ...
-
bioRxiv - Cell Biology 2022Quote: ... using Protein Assay Dye (BioRad). 20 μg protein from each sample was separated on 6% or 8% gels by SDS-PAGE and subsequently transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2020Quote: ... Protein quantification by Bio-Rad protein assay was carried out on the same lysates to normalize the B-gal data for protein content.
-
bioRxiv - Neuroscience 2021Quote: ... detergent compatible protein assays (Biorad) were carried out in duplicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... DC protein assay (Bio-Rad) was used to quantify the protein concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... Precision Plus Protein Standard (BioRad) was run as molecular weight marker ...
-
bioRxiv - Microbiology 2022Quote: ... Bradford protein assay (Bio-Rad) was used to determine protein concentration ...
-
bioRxiv - Physiology 2020Quote: ... A Biorad protein assay (Biorad) was used to quantify the protein and Coomassie protein stain (InstantBlue™ Protein Stain Instant Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Bradford protein assay (BioRad) was used to compare protein concentrations across samples.
-
bioRxiv - Genetics 2021Quote: ... Bradford protein assay (Bio-Rad) was employed to quantify proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Precision Plus Protein Kaleidoscope (BioRad) was used as a molecular weight standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured by Bio-Rad protein assay (#5000006, Bio-Rad) and equal volume and quantity of protein samples were made by addition of 4x Laemmli Sample Buffer (#1610747 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A protein transfer apparatus (BioRad) was used for transferring proteins to a Sequi-Blot PVDF membrane (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein standards from Bio-Rad were used to interprete elution profiles ...
-
bioRxiv - Cell Biology 2021Quote: ... Cholesterol concentrations were normalized by the protein concentration determined by Bio-Rad Protein Assay Dye (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... and Protein Kaleidoscope (BioRad 1610375) was used as a molecular weight marker ...
-
bioRxiv - Molecular Biology 2023Quote: ... BCA Protein Assay (Bio-Rad) was used to normalize the results to protein levels.
-
bioRxiv - Neuroscience 2023Quote: ... DC protein assay (Bio-Rad) was used to quantify protein ...
-
bioRxiv - Cell Biology 2023Quote: ... cleared supernatant was transferred to the new clean Eppendorf tubes and total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Nuclear and cytoplasmic proteins were prepared using the NE-PER nuclear and cytoplasmic extraction reagent kit (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2024Quote: ... REVERT total protein stain (BioRad) was used as indicated by manufacturer.
-
bioRxiv - Biochemistry 2023Quote: ... protein electrophoresis equipment (Bio-Rad), ChemiDoc Touch Imaging system (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... The Precision Plus Protein (Biorad) was used as a molecular weight ladder.
-
bioRxiv - Biochemistry 2023Quote: ... standard globular proteins (Bio-Rad), PrPC and recPrP ...
-
bioRxiv - Biophysics 2022Quote: ... SEC protein standards (BioRad; #1511901) were used to ensure Superose 6 column performance was adequate (Figure S4) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein concentration was measured using Bradford assay by Bio-Rad Protein Assay kit (Bio-Rad). Samples were boiled for 10 min at 96 °C in 1X Laemmli buffer (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein ladder (Biorad, catalog #: 1610395) was used to locate the molecular weight ...
-
bioRxiv - Molecular Biology 2023Quote: ... a protein mix (Bio-Rad size exclusion standard ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 μg of protein / well and Precision Plus Protein All Blue Standards (Biorad #161-0373) were run on 4-20% polyacrylamide gels (Biorad #4561096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured by Bradford assay using Protein Assay Dye Reagent Concentrate (Bio-Rad). All western blots were revealed using ECL (GE Healthcare).
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatants were collected and protein concentration was calculated by Bradford Protein Assay (Bio-rad). The denatured lysates were electrophoresed on SDS-PAGE gels and transferred to polyvinylidene fluoride membranes (BioExpress) ...
-
bioRxiv - Neuroscience 2021Quote: ... the protein concentration in the supernatant was determined using DC protein assays (Bio-rad, 5000116) with bovine serum albumin solutions as standards ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein concentration was measured with an RC DC protein assay kit (Bio-Rad; Feldkirchen, Germany). 10 μg protein per sample was loaded ...
-
bioRxiv - Physiology 2022Quote: ... Samples were loaded alongside 10 µL protein ladder (Precision Plus Protein Standards Kaleidoscope ladder, BioRad). Self-cast gels (Mini-PROTEAN ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysate protein concentration was determined using DC Protein Assay Kit II (cat# 5000112, Bio-Rad). Equivalent amounts of protein ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration in each fraction of soluble proteins was determined by Bradford assay (Bio-Rad). Specific ß-galactosidase activities in the same fractions were measured according to Miller (51 ...