Labshake search
Citations for Bio-Rad :
1001 - 1050 of 4753 citations for 8 9 Didehydro 3'N demethyl 9 deoxo 4'' 6 12 trideoxy 6 9 epoxy 3'N ethylerythromycin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... After 3 washes with TBS-T signal was developed for HRP secondaries with Clarity Western ECL Substrate (Bio-Rad). CIRBP and RPA2 expression were each measured with 3 different antibodies targeting conserved epitopes (Extended Data Figure 7c ...
-
bioRxiv - Biophysics 2023Quote: ... Blotting was done by standard mini-TGX protocol (2.5 A, 25 V, 3 minutes) using a Trans-blot Turbo Transfer System (BioRad). Membranes were incubated with UBQLN2 primary antibodies (1:5000 diluted ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2023Quote: ... qPCR was then performed on a Quantstudio 3 using the indicated targets and with iTaq Universal SYBR Green (BioRad). RQ values were calculated using a standard curve ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 12-well from BIO-RAD. Amicon centrifugal filters were purchased from Merck ...
-
bioRxiv - Systems Biology 2022Quote: ... using 12% polyacrylamide gels (BioRad) using 20 μg protein per lane ...
-
bioRxiv - Microbiology 2024Quote: ... for 12 min (Bio-Rad). Total protein was quantified using total protein stain (LI-COR ...
-
bioRxiv - Genomics 2022Quote: ... CD8 (Bio-Rad, OX-8), and CD68 (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: 5 µL aliquots of the CRISPR complex solution were buffer exchanged into 100 mM ammonium acetate using Biospin P-6 gel columns (Bio-Rad Laboratories Inc., Hercules, CA) prior to native mass spectrometry ...
-
bioRxiv - Biophysics 2021Quote: ... The cleaved sample was reloaded on the same column and the flowthrough was collected and applied to a Bio-Scale™ Mini Bio-Gel® P-6 Desalting Cartridges (Bio-rad, Hercules, CA) for desalting ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μg of total proteins were resolved on 10% polyacrylamide gels (except for 6% gels used for PERK detection) and blotted onto PVDF membranes (#1620177, Bio-Rad Laboratories, Hercules, CA, USA). The membranes were blocked with 5% not-fat dry milk or bovine serum albumin (#A7906 ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the isolates using the InstaGeneTM Matrix comprising 6% (w/v) Chelex resin for PCR-ready DNA purification (Bio-Rad #7326030; California, United States). DNA quality was checked by measuring the A260/280 ratio using NanoDrop ...
-
bioRxiv - Cancer Biology 2021Quote: ... The eluted proteins were separated by NuPAGE 4-12% Bis-Tris gel in MES SDS running buffer and transferred to a PVDF membrane (Bio-Rad, 162-0263). Tubulin beta chain protein was detected with an anti-TUBB antibody (1:500 in 5% fat-free milk solution in TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... The nascent and total protein samples were then run on a 4-12% gradient SDS-polyacrylamide gel along with Precision Plus Protein Kaleidoscope ladder (Bio-Rad, Cat #1610395). Then the proteins were transferred onto nitrocellulose membranes using either a Bio-Rad Trans-Blot Turbo Transfer system (25V ...
-
bioRxiv - Bioengineering 2022Quote: ... and an equivalent amount of protein lysate (12-15 µg) was electrophoresed on a 4-12% NuPAGE gradient gel and transferred onto low florescent polyvinylidene difluoride membranes (Bio-Rad, Cat: 1704274). Immunoblotting was performed with primary antibodies followed by secondary antibodies with the indicated dilutions ...
-
bioRxiv - Neuroscience 2021Quote: Protein lysates from SH-SY5Y cells were quantified (bicinchoninic acid protein assay, Pierce) and then electrophoresed in 4—12% Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad) in 1X TGS Tris/Glycine/SDS Buffer (10X TGS Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were boiled (95°C) and 18 µL were loaded onto a 4-20% Mini-PROTEAN®TGX™ 12 well-gel (Biorad®). After transfer onto a PVDF (Amersham Hybond ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal proportions of supernatants and pellets were run on 4-20 % gradient or 12 % SDS-polyacrylamide gels (Mini-PROTEAN TGX Precast Gels, Bio-Rad Laboratories Inc.), which were then stained with Coomassie Blue ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were loaded onto 4-12% Criterion XT precast gels and resolved by SDS-PAGE under reducing conditions (Bio-Rad Laboratories, Hercules, CA). The proteins were then electro-blotted onto a 0.45 µm nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... and separated in polyacrylamide gels at 100-140 V on ice (4-15%, Mini-PROTEAN TGX, Bio-Rad; or as described previously [12]). To detect protein-bound acrolein in spinal cords ...
-
bioRxiv - Immunology 2023Quote: ... Same protein amounts were loaded onto 4-12% NuPAGE Gels and protein was transferred to PVDF membranes by using Trans-Blot® Turbo™ Transfer System (Biorad#17001917). Membrane was blocked with 5% milk-TBS ...
-
bioRxiv - Genetics 2023Quote: ... Bromophenol blue buffer was loaded on 1.0 mm thick Criterion XT Tris acetate (poly-acrylamide) gels with a linear resolving gel gradient of 4-12% (Biorad; Lunteren, The Netherlands). Gels were run at 75 V (0.07 A ...
-
bioRxiv - Molecular Biology 2024Quote: ... Twenty micrograms of whole cell extracts were resolved on 4−12% SDS-polyacrylamide gels and transferred onto Ready gel blotting sandwiches immune-blot PVDF membranes (Biorad, Hercules, CA, USA) using a XCell II™ Blot Module (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA samples (3 μl) and master mixes (7 μl) were pipetted into a 96-well PCR plate (Bio-Rad #MLL9651) and PCR amplification performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Immunology 2020Quote: Densitometric analysis of cleaved caspase 3 immunoblots from three independent experiments were performed using the VersaDoc Imaging System (Bio-Rad) and analyzed with ImageJ 1.52p Fiji package software (https://imagej.net/Fiji) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein bound GST beads were washed 3 times in the GST lysis buffer by centrifugation at 1,000 rcf for 3 minutes and resuspended in 4X Laemmli sample buffer (Bio-Rad), heat denatured and centrifuged at 1,000 rcf for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were centrifuged for 5 min at 7,000 g and washed twice with 200 μL of 1x PBS containing 3% BSA and 0.1% (v/v) Tween-20 (BioRad, Germany). Mounting of cells for STED microscopy was performed as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were in-gel rehydrated for 16 hrs and isoelectrically focused on 7 cm pH 3-10 IPG strips to 10,000 Vh on a Protean® IEF Cell (BioRad). After focusing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 3 technical replicates and were carried out using a CFX384 TouchTM Real-Time PCR Detection System (BioRad Laboratories Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... were mixed in a 1000:3 ratio and added to the blots prior to visualization via Chemidoc Touch Imaging system (BioRad). For OmpT visualization ...
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 3-Hydroxypropionate samples were eluted through a 300 mm × 7.8 mm Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) at 55 °C using 5 mM H2SO4 (flow rate 0.6 mL/min ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA and RNA were sheared through sonication and dotted (3 µg) on the nitrocellulose membrane (BIO-RAD, Cat No: 1620112). The membrane was baked at 80⁰C for 2 h and blocked-in phosphate-buffered saline (PBS-Tween 0.05% ...