Labshake search
Citations for Bio-Rad :
951 - 1000 of 8867 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (15 μg) were loaded on 4-15% 1 D polyacrylamide Mini-PROTEAN TGX Stain-Free gels (BioRad) and run in 1X Tris Glycine SDS buffer (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 µl of prepared sample containing 6.7 µl synaptosome lysate or 1-1.5 µl SV eluate was subjected to SDS-PAGE on 4-20% gradient gels (Criterion TGX, Bio-Rad) and transferred to a PVDF membrane using a semi-dry blotting apparatus ...
-
bioRxiv - Microbiology 2024Quote: ... 7.5 mg of proteins was diluted in ChIP buffer supplemented with 0.01% SDS and precleared for 1 hr at 4°C with 50 μl of SureBeads Protein A Magnetic Beads (BioRad) and 100 μg bovine serum albumin (BSA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were spun down at maximum speed for 1 minute and run on precast 4-20% gradient acrylamide gels (BioRad) in 1X Tris-Glycine buffer containing 0.1% SDS ...
-
bioRxiv - Immunology 2023Quote: The previously obtained plasma (1 µl) and gut mucus (30 µl) were separated on a 4-15% Mini-PROTEAN TGX gel (BioRad) under non-reducing conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... was added to the reactions and the products were separated on 4% polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, Bio-Rad) in TAE (40 mM Tris ...
-
bioRxiv - Molecular Biology 2023Quote: ... Binding was performed with gentle mixing for 1 hour at 4°C and loaded onto a Poly Prep Chromatography Column (BioRad). The loaded resin was then washed 3-4 times with 6 ml Wash Buffer (50 mM sodium phosphate ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were stained with primary antibody in blocking buffer at 4°C overnight: anti-NP (1:5000, OBT1555, Bio-Rad), anti-PA ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... Brain sections were then incubated in primary antibodies at 4°C overnight (1:500, rat anti-mouse CD68, Bio-rad Cat ...
-
bioRxiv - Immunology 2021Quote: ... in a 1-to-1 ratio and separated by gel electrophoresis in a 10% Mini-PROTEAN TGX Precast gels (Bio-Rad Watford, UK). After gel electrophoresis ...
-
bioRxiv - Physiology 2021Quote: ... RNA was transferred onto a nylon membrane (Hybond-N; Biodyne B) using Trans-Blot Turbo (Bio-Rad) at 25 V for 30 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Reactions were performed using a 96 well plate with an optically clear microseal ‘B’ film (Bio-Rad). Three technical replicate reactions were performed for each biological replicate ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biophysics 2019Quote: ... and quantitated by densitometry using a DNA standard curve and Quantity One® software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...
-
bioRxiv - Bioengineering 2019Quote: One hundred microliters of polyacrylamide resin containing different ratios of 40% acrylamide (Bio-Rad 161-0140) and 2%bis-acrylamide (Bio-Rad 161-0142 ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of RNA was converted to cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad). Primers for A1/A2 transcripts were ordered directly from Liddelow et al28 ...
-
bioRxiv - Microbiology 2021Quote: ... quantitative RT-PCR was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and the CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was performed using iTaq Universal One-Step RT-qPCR Kits (Bio-Rad, cat.# 1725150). RT-qPCR primers were designed using Primer359 and are listed in Supplementary Table 13 ...
-
bioRxiv - Immunology 2021Quote: ... Products were analyzed by agarose gel electrophoresis in a ChemiDoc XRS-Quantity One Image Analyzer (BioRad)
-
bioRxiv - Cancer Biology 2022Quote: The protein expression was assayed and densitometric analysis was performed using quantity one software (Bio-Rad) as reported previously (11) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... one microgram of isolated RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (BioRad). Using the DyNAmo HS SYBR green qPCR kit (F-410L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fraction bound was determined by densitometry of raw data using Quantity One® (v4.6.7, Bio-Rad) and the following equation for specific bands and then normalized ...
-
bioRxiv - Zoology 2022Quote: gRNA was quantified by RT-qPCR using the iTaq Universal probe one-step kit (Bio-Rad) with primers and probe targeting the DENV2 envelope [27] ...
-
bioRxiv - Plant Biology 2023Quote: ... One µg of RNA was reverse-transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad). Real-time quantitative PCR was performed in a final volume of 5 µl including 10% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... iTaq Universal SYBR Green One step RT-PCR kit (cat# 1725150) was purchased from Bio-Rad. Mature miR-146a (cat# YP00204688) ...
-
bioRxiv - Neuroscience 2024Quote: ... was used for signal detection and densitometric analyses were performed using the Quantity One software (Biorad).
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR reactions were performed using the iTaq Universal Sybr green One-step kit (Bio-Rad) with the following reaction mix per sample ...
-
bioRxiv - Microbiology 2024Quote: ... with visualization on a Personal Molecular Imager FX scanner and analysis with Quantity One software (BioRad).
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using the iTaqUniversal SybrGreen one-step kit (BioRad, Hercules, Ca, USA) according to the manual protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometry analysis was performed using Bio-Rad Quantity One image analysis software (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed on CFX97 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2024Quote: ... One μg of total RNA was reverse-transcribed as per the manufacturer’s instructions (VWR and BioRad). The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mL of stacking gel solution (enough for one 1.5 mm Bio-Rad mini gel cast) was prepared by mixing together ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).