Labshake search
Citations for Bio-Rad :
51 - 100 of 203 citations for TSLPR Human HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Microbiology 2022Quote: ... and Bio-Plex Pro Human Cytokine 27-plex assay (Bio-Rad, California, USA) were used to detect urinary cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... and a goat anti-human IgG conjugated to HRP (Bio-Rad, cat. 204005) was used as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... Supernatants were analyzed using a human Th17 cell cytokine panel multiplex (BioRad 171AA001M). For flow cytometry ...
-
bioRxiv - Bioengineering 2020Quote: ... or AlexaFluor647-conjugated mouse-anti-human CD120a (TNFR1) antibodies (clone H398, Bio-Rad). DAPI was used for dead cell exclusion.
-
bioRxiv - Immunology 2023Quote: ... and Bio-Plex Pro Human IgA detection antibody (Bio-Rad, Cat No. 12014669). For both kits ...
-
bioRxiv - Pathology 2023Quote: ... Immunoglobulins were analysed using a bio-plex pro human isotyping assay (Bio-Rad) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antibodies used for SBA: Alexa 488 labeled mouse anti-human CD9 antibody (MCA469A488, Biorad), PE-labeled mouse anti human CD63 antibody (12-0639-42 ...
-
bioRxiv - Cell Biology 2022Quote: ... along with Rhodamine-conjugated ɑ-GAPDH human Fab fragment (1:1000, Bio-Rad, 12004168). The blots were imaged on the ChemiDoc MP system and quantified using Image Lab software (Bio-Rad).
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Immunology 2023Quote: ... and chemokines dosage by Luminex using the 48-Plex pan-human cytokine kit (BioRad) according to the manufacturer procedure ...
-
bioRxiv - Cell Biology 2022Quote: ... A FAM-labeled probe was used to target human STMN2 gene (dHsaCNS772300147, Bio-Rad) and a Hex-labeled probe was used to target mouse ApoB (dMmuCNS407594696 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media (for mouse or human tissue respectively) and 50 μL Alamar Blue (BioRad, BUF012B), with a corresponding media only control well ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti Human Protein Gene Product 9.5 (PGP9.5) (1:500, MCA4750GA mouse monoclonal, Biorad) for 36 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... (ii) genes in RNA virus infection panel of pre-designed human PrimePCR by BioRad; (iii ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... for detecting mLIF or Bio-Plex Pro Human Cytokine LIF Set (Bio-Rad, 171B6011M) for detecting hLIF ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... Unspecific binding was blocked by using PBS with 5% human AB serum (Bio-Rad, Germany) and 5% mouse serum (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... and human 18S genes using the iQ™ SYBER® Green Supermix (Bio-Rad, #1708880) with the following conditions ...