Labshake search
Citations for Bio-Rad :
51 - 100 of 1746 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Colorimetric (standards) and chemiluminescent detection (His-tagged proteins) were performed using the ChemiDoc Imager (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... purified RBD-Fc proteins were concentrated using 10,000 MWCO Amicon centrifugation columns (BioRad, California, USA) and stored at 4°C before use ...
-
bioRxiv - Cell Biology 2024Quote: ... and FLAG-bound proteins were eluted with 4x Laemmli sample buffer (Bio-Rad). The samples were boiled for 3 min before undergoing SDS-PAGE.
-
bioRxiv - Microbiology 2021Quote: ... and then incubated for at least 16 hours at 4°C with either mouse monoclonal anti-His (1:2,000; AD1.1.10, Biorad) or mouse anti-RNA pol (1:5,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... and the protein was passed through Hi-Q anion exchange column (Bio-Rad Laboratories, Hercules, CA, USA) to remove minor nucleic acid contamination ...
-
bioRxiv - Plant Biology 2021Quote: Purified His and GST fusion proteins or GST alone (500 ng) were blotted onto nitrocellulose membrane (BioRad). The nitrocellulose membrane was rinsed with TBS-T buffer (10 mM Tris-HCl at pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... Eluents were collected and incubated with 50μL of packed Ni-NTA resin (Bio-Rad His-Pur 88222) at room temperature with nutating for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cultures were induced with IPTG and His-MBP-ORC2 was purified on Ni-NTA beads (BioRad). Purified protein was injected into rabbits for serum generation and collection (Cocalico Biologicals) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged σs was added to phosphorylated/unphosphorylated RssB in Micro Bio-Spin Chromatography columns (Bio-Rad) before removing 6μL of the input for SDS-PAGE analysis and adding 40μL of prepared HisPur Ni-NTA resin (Thermo Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Microbiology 2020Quote: ... was used to purify the C-terminal 6X-His EfgA with 1 mL Ni-NTA columns (Bio-Rad). Columns were equilibrated with 10 mL of Buffer A at 1 mL/min prior to loading lysates ...
-
bioRxiv - Biochemistry 2022Quote: ... and eluted from the C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad) by the acidic acetonitrile gradient.
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins in the cleared lysate were purified using Profinity™ IMAC Nickel Charged Resin (Bio-Rad) and eluted in 50 mM sodium phosphate buffer with 300 mM NaCl pH 8 and 300 mM imidazole (Fischer Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Cancer Biology 2019Quote: ... a bottom layer containing RPMI 1640 medium (10% CS-FCS) and 0.75% low melting agar (Bio-Rad) was overlain with half the volume of RPMI 1640 medium (10% FCS ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were stained overnight at 4°C with a 1:1000 diluted mouse anti-his primary antibody (MCA1396, RRID:AB_322084, Bio-Rad) and then for 1 hour at room temperature with a 1:4000 diluted rabbit anti-mouse HRP secondary antibody (SouthernBiotech Cat# 6170-05 ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... The refolded mature FAM237A was eluted from the C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad) by the acidic acetonitrile gradient.
-
bioRxiv - Microbiology 2023Quote: ... Ni-NTA agarose with the bound His-SUMO-SigN was loaded on a Poly-Prep® Chromatography Column (Bio-Rad), washed with P2 buffer and subsequently with the P2 buffer with the 30 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... The was filtered through a 0.45 μm filter and His-MSI-2 was purified with HisTrapTM FF column (Cytiva) using the Econo Gradient Pump (BIORAD) according to the manufacturer’s protocol and overnight dialysis ...
-
bioRxiv - Immunology 2023Quote: ... to block Fc receptors and stained with biotinylated anti-mouse F4/80 (clone: Cl:A3-1, cat:MCA497B, BIO-RAD), PerCP-Cy5.5-conjugated streptavidin (551419 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2020Quote: Fifteen micrograms pGuide-HCFC1-N and 10 μg pCRIS-mCherry-FLAG-dTAG-HCFC1 were electroporated (BioRad, Hercules ...
-
bioRxiv - Biophysics 2023Quote: ... NICD-FLAG-containing lysates were separated on a 7.5% acrylamide Mini-PROTEAN TGX gels (Bio-Rad) and transferred to PVDF membranes using a Trans-Blot Turbo semi-dry transfer system (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: Purified recombinant His-tagged proteins were diluted to 0.5µg/ml in either Laemmli sample buffer alone (Bio-Rad, Hercules, CA, USA) or containing 50 mM dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...