Labshake search
Citations for Bio-Rad :
51 - 100 of 261 citations for Recombinant Human S100P None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... His-tagged protein was detected using a mouse anti-6×His IgG conjugated to horseradish peroxidase (MCA1396P; Bio-Rad), and the blot was developed using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and antimouse secondary antibody (Biorad; 1:10,000). GroEL was used as cytoplasmic control and detected as above ...
-
bioRxiv - Plant Biology 2024Quote: ... in 0.5 % milk in TBS-Tween 0.1 % to reveal HA-tagged NIN proteins following chemiluminescence revelation using the Clarity Western ECL Substrate (Bio-Rad) and the ChemiDoc Touch imaging system (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... the membranes were incubated with fluorescent tagged secondary antibodies for 45 minutes at RT followed by imaging on a fluorescence scanner imaging system (Biorad).
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Bioengineering 2019Quote: Equal volumes of (GT)6-Cy5-SWCNT and FAM-tagged protein at 2X working concentration were added to a 96-well PCR plate (Bio-Rad) to a total volume of 50 μL ...
-
bioRxiv - Systems Biology 2021Quote: ... each supernatant sample was run in duplicate and volumetric band intensities were fitted onto a standard curve generated by a dilution series of HPC4-tagged EPO on the same membrane using the Image Lab software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... The recovery of tag-less MlaC was quantified using the ratio standard curve method (41) while that of His-tagged nanodisc-embedded complexes were quantified using the Lowry assay (DC Protein Assay, Bio-Rad). For retrograde assay ...
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescently tagged/labeled expressed protein was detected both before and after SDS-PAGE using a Chemidoc MP imaging system (Bio-Rad, Laboratories Pty ...
-
bioRxiv - Microbiology 2022Quote: ... His6 tagged proteins were detected with anti-His6 primary antibody (Pierce; 1:6,000) and anti-mouse secondary antibody (Biorad; 1:10,000). GroEL was detected with anti-GroEL primary antibody (Pierce ...
-
bioRxiv - Molecular Biology 2022Quote: ... the membranes were incubated with anti-mouse or –rabbit secondary antibodies tagged with horseradish peroxidase (1/10 000, Bio-Rad Laboratories) for one hour at room temperature and visualized by chemiluminescence (Amersham ECL prime western blotting detection reagent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Membranes were then washed 3 times with 1X TBST for 10 minutes each before being transferred to a solution containing enhanced chemiluminescence (ECL) substrate to allow visualization of His-tagged sfGFP (Bio-Rad). The blotted proteins were visualized in a ChemiDoc Imaging System (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... 25 µg or 50 µg of normalized protein for LapA-HA or MapA-HA tagged strains respectively was mixed with 4x Laemmli Sample Buffer (Bio-Rad) and 2-mercaptoethanol to a 1x working dilution and samples were boiled for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... the cell lysates or recombinant protein were loaded on a 4-20% Criterion gel (BioRad, 3450032) for SDS-PAGE and transferred to PVDF membrane (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant proteins were affinity-purified from cleared lysates using a NGC Quest Plus FPLC system (Biorad) and GSTrap HP (GST-tagged BmVreteno and GST) ...
-
bioRxiv - Immunology 2023Quote: ... Both sets of recombinant proteins were quantified using the Bradford protein quantification assay (Bio-Rad, UK).
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Developmental Biology 2021Quote: ... by immunoprecipitation of endogenous or endogenously Flag-tagged Piwi (eF-Piwi): The anti-Piwi antibody and Surebeads Protein A Magnetic bead (Bio-Rad, 1614013) were used to immunoprecipitated endogenous Piwi-piRNAs from witld type OSC ...
-
bioRxiv - Pathology 2019Quote: ... Affi-gel 10 affinity resins were covalently cross-linked to his-tagged GT198 protein as antigen for affinity purification of anti-GT198 according to the manufacturer’s protocol (Bio-Rad, Hercules, CA). FFPE tumor sections or tumor microarrays were deparaffinized and dehydrated through xylene and ethanol series ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel carrying the recombinant proteins and their derivatives was eventually stained with Coomassie Blue (Bio-Rad) for 1 hour and was de-stained with a de-staining solution (20% methanol and 10% acetic acid in water).
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: Ramos B cells were retrovirally transduced with a construct encoding spike protein tagged with the fluorophore mScarlet at the C-terminus and sorted by FACS (Bio-Rad S3e Cell Sorter). For the experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...