Labshake search
Citations for Bio-Rad :
51 - 100 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were then developed with an ECL reagent kit (BioRad) or Li-COR imaging system ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed and developed using ECL kit (BioRad). Image analysis and quantification were performed using ImageLab software (BioRad).
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was washed and developed using ECL kit (BioRad). Image analysis and quantification were performed using ImageLab software (BioRad).
-
bioRxiv - Neuroscience 2021Quote: ... The total membrane protein concentration was determined using a Bradford assay (Cat# 5000006, BioRad, Hercules, CA). Purified ...
-
bioRxiv - Immunology 2024Quote: ... The final yield of plasma membrane protein was measured by micro–DC Protein Assay (Bio-Rad) and found to be between 55-57 mg for each sample ...
-
bioRxiv - Pathology 2022Quote: ... using Bio-Rad Protein Assay Kit II (Bio-Rad), or DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were quantified by DC Protein Assay Kit (BioRad). Gel electrophoresis was run in Criterion TGX Stain-Free Gels (BioRad) ...
-
bioRxiv - Immunology 2023Quote: ... normalized using the DCA Protein Assay Kit (Bio-Rad), and were subsequently incubated with 40 μL of anti-FLAG-M2 agarose resin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Rad Protein Assay Kit II (Bio-Rad laboratories) was used to measure the acetylated tubulin concentration from the post-nuclear supernatant collected from the lysates ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentrations were measured using Bradford assay kits (Biorad).
-
bioRxiv - Developmental Biology 2023Quote: ... serial dilutions and the “DCTM Protein Assay” kit (BioRad). Absorbance was measured at 690 nm using a microplate spectrophotometer ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... and protein concentration determined with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). The immunoprecipitation of FLAG-Myc was performed by incubating 2 mg of cell lysate with 40 µl of Anti-FLAG M2 affinity gel (Sigma-Aldrich #A2220 ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... cell extracts were quantified with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). After addition of 6X Laemmli buffer (375 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supernatants were collected and protein concentration determined using the Bradford assay (BioRad Protein Assay Kit, USA). Proteins were homogenized in Sample buffer 1X in PBS [Laemmli ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration was determined using the Bradford assay (Bio-Rad Protein Assay kit, Bio-Rad, USA). Equal amounts of protein from each sample were dissolved in sample buffer [Laemmli with 5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentration was determined using the Bradford assay (Bio-Rad Protein Assay kit, Bio-Rad, USA). Equal amounts of protein from each sample were dissolved in sample buffer [Laemmli with 5% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... the same samples were run in parallel in a Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad). For mass spectrometry assay ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes and solutions used were provided with the transfer kit (TBT RTA TRANSFER KIT, BioRad). To confirm protein transfer ...
-
bioRxiv - Physiology 2023Quote: ... protein content in the soluble fraction of homogenates was measured using a RC-PC protein assay kit (DC Protein Assay Kit, Bio-Rad, Hercules, CA), and then dissolved in Laemmli buffer.
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined using a commercial colourimetric assay (Bio-Rad Protein Assay kit II, Bio-Rad Laboratories Pty Ltd ...
-
bioRxiv - Plant Biology 2022Quote: ... Concentration of nuclear proteins was determined using the Bradford assay (Protein Assay Kit II, Bio-Rad, USA). Nuclear protein extract (20 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... After the protein concentration was measured via Lowry assay using DCTM Protein Assay Kit (BIO-RAD, 5000111), the same amount of total protein was used for each pulldown (2-3 mg per pulldown) ...
-
bioRxiv - Physiology 2024Quote: ... Protein estimation was performed using DC protein assay (DC™ Protein Assay Kit II, Cat# 5000112, Biorad). Proteins were diluted in 4x Laemmli sample buffer ...
-
bioRxiv - Physiology 2024Quote: ... Protein estimation was performed using DC protein assay (DC™ Protein Assay Kit II, Cat# 5000112, Biorad). Proteins were diluted in 4x Laemmli sample buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentration was determined using a commercial colorimetric assay (Bio-Rad Protein Assay kit II, Bio-Rad Laboratories Pty Ltd ...
-
bioRxiv - Bioengineering 2020Quote: ... A pre-stained molecular weight marker was run in parallel to determine the molecular weight of the proteins (BioRad, #1610375).
-
bioRxiv - Microbiology 2020Quote: ... The Lowry protein assay (kit from BioRad Laboratories, Hercules, CA) was used to standardize protein concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein was quantified by DC Protein Assay kit (Bio-Rad). The same amount of protein (15 μg ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were determined using Protein Assay Kit (BioRad, 5000002). Prior to loading ...
-
bioRxiv - Neuroscience 2021Quote: ... A DC protein assay kit (#5000111, Bio-Rad, Watford, UK) was then used to determine total protein content and 40µg of total protein from each relevant sample was separated on 12% SDS-PAGE ...
-
bioRxiv - Physiology 2022Quote: ... Protein levels were determined by Bradford assay kit (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... ECL assay kit were purchased from Bio-Rad (California, CA). WA were purchased from ChromaDex (Irvine ...
-
bioRxiv - Cell Biology 2021Quote: ... determined spectrophotometrically using the DC Protein Assay kit (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently qPCR-amplified using SYBR Primer Assay kits (Biorad). Notably ...
-
bioRxiv - Neuroscience 2022Quote: ... A DC Protein Assay kit (Bio-Rad; Hercules, CA, USA) was used to determine protein concentrations by which total protein was equalized across samples at 1 µg/µl ...
-
bioRxiv - Genomics 2024Quote: The ZDC Multiplex RT-PCR Assay Kit (Bio-Rad, USA) was used to detect the presence of Zika ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentration was determined by DC protein assay kit (Biorad). Protein samples were prepared in 1x Laemmli loading buffer (Biorad ...
-
bioRxiv - Microbiology 2023Quote: ... and a protein assay kit (Bio-Rad Laboratories, Carlsbad, CA) was used to calculate the protein concentrations.
-
bioRxiv - Molecular Biology 2023Quote: ... Protein was quantified using the DC Assay kit (Bio-Rad) and diluted in SDS Sample Buffer (125 mM Tris pH 6.8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was measured using DC protein assay kit (BioRad). The sample concentrations were normalized prior to the submission for the analysis by Eve Technologies DM-44 mouse Discovery Assay panel.
-
bioRxiv - Cell Biology 2023Quote: ... Protein was quantified using the DC Protein Assay kit (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Protein concentrations were determined with a Bradford assay kit (BioRad). For separation by electrophoresis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein concentrations were determined using the DC assay kit (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2024Quote: ... 1.25 µL ddPCR™ probe assay Kit (Bio-Rad Laboratories) which consist of forward (CGCAATCCTTTATTCTGTTCGA ...
-
bioRxiv - Biochemistry 2022Quote: ... Bio-Rad protein assay dye regent (#5000006) and 0.45 µm nitrocellulose membrane (#1620115) were purchased from Bio-Rad.
-
Tuning Cell-free Composition Controls the Time-delay, Dynamics, and Productivity of TX-TL ExpressionbioRxiv - Synthetic Biology 2021Quote: ... The protein concentration of the retentate was quantified using a Bradford BSA Protein Assay Kit assay (Bio-Rad). The retentate was aliquoted and flash-frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... protein concentrations were determined using the Bio-Rad Protein Assay Kit (Bio-Rad protein assay Dye reagent concentrates). Samples were counterbalanced by sex and drinking history across gels for Western-Blot ...
-
bioRxiv - Neuroscience 2023Quote: ... total protein concentration was measured using a protein assay (DC™ Protein Assay Kit II, BIO-RAD, 5000112). Activin A measurements were normalized to total protein levels ...
-
bioRxiv - Plant Biology 2024Quote: ... and protein concentration was determined by the DC Protein Assay Kit (Bio-Rad, based on the Lowry assay). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the proteins were transferred to a nitrocellulose membrane (midi kit, Bio-Rad) with Trans-Blot Turbo Transfer System (Bio-Rad) ...