Labshake search
Citations for Bio-Rad :
51 - 100 of 221 citations for LD78 beta CCL3L1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Neuroscience 2021Quote: ... Target proteins were detected by chemiluminescence with Clarity™ (Beta-actin and GFP) and Clarity Max™ (SP) Western ECL Substrate kit (Bio-Rad®) on the Odyssey FC system (LI-COR) ...
-
bioRxiv - Neuroscience 2019Quote: ... or BIC (20 μM) were added to the culture and cells were harvested with a 1:1 mixture of 2X Laemmeli buffer (BioRad, 1610737, 1:20 beta-mercaptoethanol) and radioimmunoprecipitation assay (RIPA ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad, USA; 171B6022M) were used ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Cancer Biology 2021Quote: ... and resuspended in FACS buffer with Fc-block (Human Seroblock, Bio-Rad). These samples were then re-pelleted and suspended in a cocktail of fluorophore-conjugated primary antibodies (Supp ...
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...
-
Antiviral roles of interferon regulatory factor (IRF)-1, 3 and 7 against human coronavirus infectionbioRxiv - Microbiology 2022Quote: ... human IFN-γ and IFN-λ 1 were obtained from Bio-Rad, BD Pharmingen and R&D Systems respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... and G-CSF quantification using a human Bio-plex PRO assay (Biorad) following the manufacturer’s instructions and acquired with the Luminex200 instrument (Luminex).
-
bioRxiv - Immunology 2023Quote: ... A human RPP30 copy number assay labeled with HEX (Bio-Rad, dHsaCP1000485) was used to measure total allelic copy numbers ...
-
bioRxiv - Immunology 2023Quote: ... with human IgA positive and negative controls (Bio-Rad, Cat No. 12014775), Bio-Plex SARS-CoV-2 Wuhan-1 strain RBD and N coupled beads (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-Rad using HuCAL technology ...
-
bioRxiv - Physiology 2023Quote: Human recombinant monoclonal antibodies to mouse ERFE were produced by Bio-rad using the HuCAL technology ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Microbiology 2022Quote: ... and Bio-Plex Pro Human Cytokine 27-plex assay (Bio-Rad, California, USA) were used to detect urinary cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... and a goat anti-human IgG conjugated to HRP (Bio-Rad, cat. 204005) was used as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... Supernatants were analyzed using a human Th17 cell cytokine panel multiplex (BioRad 171AA001M). For flow cytometry ...
-
bioRxiv - Bioengineering 2020Quote: ... or AlexaFluor647-conjugated mouse-anti-human CD120a (TNFR1) antibodies (clone H398, Bio-Rad). DAPI was used for dead cell exclusion.