Labshake search
Citations for Bio-Rad :
51 - 100 of 291 citations for IL 18 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Whole cell lysates were loaded into 4-20% Criterion TGX Precast 18 well gels (Bio-Rad, cat # 5671094) and separated by electrophoreses at 120 V for 1 hr ...
-
bioRxiv - Genetics 2020Quote: ... and 15μL/lane was loaded into an 18-well 4–20% Criterion TGX Gel (Bio-Rad 567-1094). Gels were run at 90 volts for 30 minutes followed by 150 volts for 50 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 25 µg of protein was loaded per well into an 18 well 10% TGX™ Precast Gel (BioRad), submerged in running buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples were then separated using an 18-well 4-20% Criterion TGX gel (Bio-Rad, Hercules, CA) in a Bio-Rad western blot apparatus ...
-
bioRxiv - Biochemistry 2021Quote: ... immobilized pH gradient (IPG) strips of 18 cm having a pH range 4-7 (Ready Strips, Bio-Rad) were used and were rehydrated overnight at RT ...
-
bioRxiv - Genomics 2023Quote: ... Gene panel probe hybridization occurred overnight for 18 hours at 50°C (Bio-Rad DNA Engine Tetrad 2). Subsequent washes the next day removed unbound probes ...
-
bioRxiv - Microbiology 2021Quote: ... and data was analysed using the QuantaSoft Software (Bio-Rad, IL USA). Genomic DNA of SN15 (- ...
-
bioRxiv - Immunology 2023Quote: ... IL-17 and MIP-1α by multiplex immunoassay (Bio-Rad, Hercules, CA).
-
bioRxiv - Immunology 2021Quote: ... rat anti-human CD8 (Bio-Rad), rat anti-human Granzyme B (eBioscience) ...
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... Corresponding fractions for each chromatogram between 12 and 18 ml with an interval of 0.5ml were analyzed by SDS-PAGE (Biorad) and Instant blue coomassie staining (Expedeon).
-
bioRxiv - Molecular Biology 2022Quote: ... Plates were incubated for 18 to 24 h at 37°C and imaged in a ChemiDoc Imaging System (BioRad) to detect RFP and GFP fluorescence (Cy3 and Cy2 channels ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Microbiology 2021Quote: ... IL-1β gene expression was quantified by PrimePCR FAM Probe assay (Bio-rad) using SsoAdvanced Universal Probes Supermix (Bio-rad ...
-
bioRxiv - Microbiology 2019Quote: ... and IL-1 β were measured with Bio-Plex® custom Assay (BIORAD) using a Bio-plex 200 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Octamers were visualized using 18% separating (4% stacking) discontinuous Laemmli SDS-PAGE in Mini-Protean gel running system (Bio-Rad) run for 70 minutes at 22mA ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples from PKC and cross-linking assays were loaded on 18% Tris-Glycine Stain-Free gels (Bio-Rad, 5678073 CA); samples from heart lysates were loaded on 10% Tris-Glycine Stain -Free gel (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μg of total RNA from wild-type HEK293T and C6orf203-KO cells were resolved on a 1.5% agarose gel containing 18% formaldehyde and transferred to a ZETA-PROBE GT membrane (Bio-Rad). Probes used for hybridization were 32P-labeled specific antisense ssRNA corresponding to 16S-rRNA gene (or MT-RNR2) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 sgS and sgN transcripts and 18S rRNA were quantified by ddPCR with specific primers using an automated droplet generator and droplet reader (BioRad).
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cell Biology 2023Quote: ... For each sample 20 μg of K562 cell extracts were loaded on 6-18% hand-casted acrylamide SDS-PAGE gradient gel (40% Acrylamide/bis-Acrylamide solution, BioRad). After separation by electrophoretic run ...
-
bioRxiv - Molecular Biology 2024Quote: ... TBP (Gene ID: 6908) and 18S (RNA18SN5, Gene ID: 100008588) cDNA levels using the CFX Manager 3.1 software (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted using PureZOL reagent (Bio-Rad Laboratories, Des Plaines, IL, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was subsequently loaded into the QX200 Plate Reader (Bio-Rad, IL USA) and data was analysed using the QuantaSoft Software (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... run on a CFX96 Real-Time System (Bio-Rad Laboratories, Des Plaines, IL, USA). Relative mRNA expression of each gene of interest (GOI ...
-
bioRxiv - Cell Biology 2020Quote: ... The relative levels of gene transcripts compared with the control gene 18S were determined by quantitative real-time PCR using SYBR Green PCR Supermix (Bio-Rad) and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: Library preparation for RNA extracted from NveAGO1 and NveAGO2 IP was size selected for 18-30 nucleotides on 15% denaturing urea polyacrylamide gel (Bio-Rad) followed by overnight RNA elution in 0.3M NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... The relative levels of gene transcripts compared to the control gene 18S were determined by quantitative real-time PCR using SYBER Green PCR Supermix (Bio-Rad) and specific primers on a 7,500 Fast Transient transfection Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... Assays comprising of premixtures of a forward and reverse primer (18 μM each) with a FAM- or HEX-conjugated hydrolysis probe (5 μM) were either purchased from Bio-Rad, based on previous publications (Roberts et al. ...
-
bioRxiv - Biophysics 2021Quote: ... was folded into the desired shape by self-assembly with a six-fold molar excess of designed “staple strands” by heating and cooling cycles over an 18-hour period in a thermocycler (Bio-Rad). Excess staples were removed by PEG precipitation105 ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used for qPCR employing 2 μL of cDNA sample and 18 μL mix of master mix (water, primers and qPCR mix) per well in 96-well plates (HSP9601, Bio-Rad), which were sealed using transparent film (MSB1001 ...
-
A bacterial signal transduction phosphorelay in the methanogenic archaeon Methanosarcina acetivoransbioRxiv - Microbiology 2021Quote: ... then separated via SDS-PAGE and transferred onto a PVDF membrane (18 min, 15 V) by Trans-Blot® SD semi-dry Western blot (BioRad). The membrane was exposed as described before overnight to a PhosphoImager screen ...
-
bioRxiv - Cancer Biology 2019Quote: ... After in-chip RT/Amp amplification (18 amplification cycles, in-chip RT/Amp Rapid Development protocol) inside a modified SmartChip Cycler (Bio-Rad), libraries were pooled ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates of WT OSC were incubated with 1μg of Rabbit anti-Piwi polyclonal antibody (18) and 30 μl Surebeads Protein A Magnetic beads (Bio-Rad, 1614013). Immunoprecipitation was performed at 4°C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... 18-5mm Lens) under UV light and leaves were scanned using a laser scanner (Molecular Imager® PharosFX™ Systems, BioRad) at 50µm per pixel ...
-
bioRxiv - Biochemistry 2023Quote: 15µg was loaded on a 4-20% acrylamide gradient gel with 18 or 26-wells (Bio-Rad #5671094 & Bio-Rad #5671095) and separated for 20min at 100v followed by 150V for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... The relative levels of gene transcripts compared with the control gene 18S were determined by quantitative real-time PCR using SYBR Green PCR Supermix (Bio-Rad) and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: 15µg was loaded on a 4-20% acrylamide gradient gel with 18 or 26-wells (Bio-Rad #5671094 & Bio-Rad #5671095) and separated for 20min at 100v followed by 150V for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...