Labshake search
Citations for Bio-Rad :
51 - 100 of 5481 citations for FabFc ZAP human Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Human (Bio-Rad, 10031243, ID: dHsaCP1000002). Reference assay for 3.1 kb deletion and 3.1 kb inversion assays ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human CX3CR1 (Biorad, AHP1589), mouse anti-human CD68 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human CX3CR1 (Bio-Rad, AHP566). Mouse TNFα ELISA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: IgE receptor cross-linking (IgECL) on HSMCs was accomplished through sensitization with 1 μg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA) for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit, Bio-rad) (36) ...
-
bioRxiv - Biochemistry 2021Quote: ... The antigen-antibody complexes were visualized using appropriate HRP conjugated secondary antibodies and enhanced chemiluminescence kit (ECL; Amersham or Bio-Rad) and normalization was reported to β-actin ...
-
bioRxiv - Biochemistry 2021Quote: The details of the protein purification protocol for human plasma sample are described in the Aurum serum mini kit leaflet and a detailed was followed(BioRad, USA). The sample was prepared for 2-D gel electrophoresis following passive rehydration for 16-24 h ...
-
bioRxiv - Genomics 2020Quote: ... The concentrations of cytokines in plasma were measured using the Bio-Plex Pro™ Human Cytokine 17-plex Assay kit immunoassay run on the Bio-Plex 200 (BioRad), with reference to an 8 point standard curve.
-
bioRxiv - Immunology 2021Quote: ... Serum was also collected for cytokine analyses which were performed by the University of Pennsylvania’s Human Immunology Core using a Non-Human Primate Cytokine Panel kit (MilliporeSigma, Cat# PCYTMG-40K-PX23) on a Bio-Plex 200 instrument (Bio-Rad) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: Plasma from each patient sample was analyzed using the Bio-Plex Pro™ Human Cytokine 17-plex Assay kit (Bio-Rad). Cytokine expression was measured using the Luminex xMAP® (Luminex Corporation ...
-
bioRxiv - Immunology 2021Quote: ... Sera were collected for cytokines analyses which were performed by the Macau University of Science and Technology using a Non-Human Primate Cytokine Panel kit (MilliporeSigma, Cat# PCYTMG-40K-PX23) on a Bio-Plex 200 instrument (Bio-Rad) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Serum cytokines were measured using the Luminex xMAP technology on the Bio-Plex 200 platform (Bio-plex Manager 5.0) with the Bio-Plex Pro™ Human Cytokine Screening Test Kit (48-Plex, Bio-Rad) and the Bio-Plex Pro™ Human Inflammation Panel-1 Kit (37-Plex ...
-
bioRxiv - Microbiology 2024Quote: ... and human proinflammatory cytokines were quantified using the Bio-Plex Pro™ Human Inflammation Panel 1 (BioRad). Fluorescence was read using a MAGPIX System (Luminex ...
-
bioRxiv - Immunology 2020Quote: ... Multiplexed cytokine measurements on macrophage cell culture supernatants were performed using a custom Bio-Plex Express Human Cytokine kit (Bio-Rad 17004073) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... monoclonal rat anti-human CD3 (Bio-Rad), rat anti-mouse B220/CD45R (clone RA3-6B2 ...
-
bioRxiv - Immunology 2023Quote: ... goat-anti-human 1:3000 (Biorad /1721050); goat-anti-rabbit 1:2000 (CST / 7074) ...
-
bioRxiv - Genetics 2020Quote: ... and was quantified by using a QuantifilerR Human DNA Quantification Kit (Applied Biosystem, USA) on a Bio-Rad Real-time PCR System (Bio-Rad Laboratories, USA). The quantification process was performed per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: PDEC cytokine secretion was analyzed from cleared PDEC culture supernatants using Bio-Plex Pro Human Cytokine 27-plex assay kit (Bio-Rad, cat. M500KCAF0Y) and Bio-Plex 200 System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine levels in cell culture supernatants was determined using the Magnetic Luminex Performance Assay (Human Base Kit A; R&D Systems, coupled with the Bio-Plex 200 (Bio-Rad). The trimmed median value was used to derive the standard curve and calculate sample concentrations.
-
bioRxiv - Cancer Biology 2020Quote: ... The antigen/antibody target signals were detected using an enhanced chemiluminescent detection kit (ECL-BioRad) and chemoluminescent detection using BioRad VersaDoc molecular imager and Software ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Microbiology 2020Quote: ... Levels of the following 27 cytokines were analyzed using a BioPlex Pro™ Human Cytokine 27-plex Assay kit (#M500KCAF0Y, Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were incubated with APC (Lynx Rapid APC antibody conjugation kit, Cat # LNK031APC, Bio-Rad Laboratories, Inc.)-conjugated cytokeratin 6 (CK6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pd-PR and Ac-PR were detected using antiFlag antibody with clarity western ECL substrate kit (Bio-Rad).
-
Farnesyltransferase inhibition overcomes the adaptive resistance to osimertinib in EGFR-mutant NSCLCbioRxiv - Cancer Biology 2022Quote: Detection was performed using peroxydase-conjugated secondary antibodies and chemiluminescent detection kit (Clarity™ Western ECL, Bio-Rad) with a ChemiDoc™ MP Imaging system (Bio-Rad).
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Microbiology 2023Quote: ... anti-CD8-PerCP-Cy5.5 (clone CT8, Southern Biotech, LYNX Rapid PerCP Antibody Conjugation Kit, Bio-rad, Feldkirchen, Germany), anti-CD45-APC (clone UM16-6 ...