Labshake search
Citations for Bio-Rad :
51 - 100 of 2980 citations for Dectin 1 CLEC7A Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Blocked membranes were incubated with HuCAL anti-bovine Mincle CRD antibodies (2.5 µg mL-1) before incubation with secondary goat-anti-human IgG F(ab’)2: HRP (STAR126P, Bio-Rad) antibody ...
-
bioRxiv - Cancer Biology 2019Quote: ... a bottom layer containing RPMI 1640 medium (10% CS-FCS) and 0.75% low melting agar (Bio-Rad) was overlain with half the volume of RPMI 1640 medium (10% FCS ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with 0.4 µg/mL rabbit -anti-human CD20 polyclonal antibodies (Neomarkers) and 2 µg/mL rat-anti-human CD3 antibodies (clone MCA1477, BioRad). Then ...
-
bioRxiv - Microbiology 2020Quote: ELISA plates were coated overnight at 4°C with 0.1 µg/mL of mouse anti-human IgG (human CH2 domain with no cross-reactivity to rhesus macaque IgG; clone R10Z8E9; BioRad) and then blocked for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A titres in human serum samples were quantified using a multiplex cytokine panel (Bio-Plex Pro Human Cytokine Assay, BioRad) and a LuminexCorp Luminex 100 machine as per the manufacturer’s instructions.
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... The recombinant Human IgG1 Kappa (Biorad, cat.no. HCA192) was used as a positive control ...
-
bioRxiv - Microbiology 2019Quote: ... anti–human IgG conjugated with HRP (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Bio-Rad 172-1033) and anti-Rat IgG-HRP (Thermo Fisher 31470).
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Cancer Biology 2021Quote: ... For immunohistochemistry (IHC) experiments following primary antibodies were used: IgG anti-human CD3 antibody (1:200, clone CD3-12, Bio-Rad) and anti-PCNA antibody (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... Slides were incubated overnight at 4 °C with the following primary antibodies (1:100, in blocking buffer): mouse anti-human MBP (BMK-13, antihuman MBP (BMK-13, MCA5751 Bio-RAD), rabbit anti-human PD-L1 (E1L3N ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were incubated for one hour either with a 1:5 dilution of Rat anti Human CD3:Alexa Fluor®647 (0.05 mg/mL) (clone CD3-12; Bio-Rad) or with undiluted CD8 (AM22 ...
-
bioRxiv - Microbiology 2024Quote: ... IL-28A/IFN-λ2 and IL-29/IFN-λ1) using a Bio-Plex ProTM Human Inflammation Panel 1 Express assay (Bio-Rad Laboratories Ltd. ...
-
bioRxiv - Immunology 2022Quote: The collected fractions were then pooled by the expected oligomeric state for both human milk and serum and again IgAs were captured on beads with a 1% blocking buffer background (Bio-Rad, Netherlands) and addition of the 7D8-IgA1 and 5D5v2-IgA1 at 0.2 μg/mL ...
-
bioRxiv - Neuroscience 2021Quote: Autaptic murine striatal neurons (DIV 15-18) were incubated with 1 μg/ml human GABAAR mAb or control antibody (anti-CD52, Bio-Rad, #HCA175) at 37°C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Levels of inflammatory cytokines were quantified using Bio-Plex Pro Human Inflammation Panel 1 37-plex (#171AL001M) magnetic bead-based assay (Bio-Rad Laboratories) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Pro-inflammatory and pro-fibrotic mediators were measured in 50µl of cell-free tissue culture supernatants using a 37-Plex Bio-Plex Pro™ Human Inflammation Panel 1 (Bio-Rad #171AL001M) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Immunology 2023Quote: IgE receptor cross-linking (IgECL) on HSMCs was accomplished through sensitization with 1 μg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA) for 24 hours ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Immunology 2022Quote: ... Pre-designed human gene primers were purchased from Bio-Rad (supplemental Table). Human PPIA was amplified in parallel and used as the reference gene in quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... with goat anti-human IgG F(ab’)2-HRP (STAR126P, Bio-Rad) as the detection antibody.
-
bioRxiv - Biophysics 2020Quote: ... and mouse anti-human CD34 (QBEND 10 clone, Ms IgG1, Bio-Rad). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human primers for HLA-DRB1 and VCAM1 were purchased from Bio-Rad.
-
bioRxiv - Immunology 2020Quote: ... and incubated with either FITC-conjugated Sheep Anti-Human C3 (BioRad AHP031F) at 1:500 or AF488-conjugated Mouse Anti-C5b-9 (ae11 ...