Labshake search
Citations for Bio-Rad :
51 - 100 of 5344 citations for 7 Diethylamino 3 ethylamino 2 methylphenoxazin 5 ium tetrachlorozincate 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Biochemistry 2019Quote: ... 25 mg ml−1 Bio-Beads SM-2 (Bio-Rad) was added and incubated at 4°C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... diluted 2:1 in 4X Laemmli sample buffer (Bio-Rad) containing 100 mM Dithiothreitol (CAS No ...
-
bioRxiv - Microbiology 2022Quote: ... Capacitors were 1-cm Tygon tubing (2 mm ID, BioRad), having Luer connectors on each extremity ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were transferred to a PVDF membrane (0.2 µm pore size) using the Trans-Blot® Turbo™ semi-dry transfer system (7 min mixed MW MIDI program) (Bio-Rad). After blocking in a 2.5% (w/v ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-α tubulin (YL1/2) (MCA77G, Bio-Rad; 1:1500). Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (H + L ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Bioengineering 2021Quote: ... samples were mixed 1:1 with 2x Laemmli sample buffer with 2-mercaptoethanol (Bio-Rad) and boiled for 10min ...
-
bioRxiv - Biophysics 2020Quote: ... We visualized the transcription products by electrophoresis in a denaturant gel (23% polyacrylamide, 7 M urea) run at 800V for 2 h (Bio-rad, Hercules, CA, USA).
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Immunology 2019Quote: ... and 2-Mercapoethanol (BIO-RAD) was added to every protein sample with 5 minutes boiling prior to running on gels for western blots ...
-
bioRxiv - Biophysics 2019Quote: ... Bio-Beads SM-2 (Biorad) were added to a 50 mg ml-1 concentration and incubated at 4° C overnight to remove detergent.
-
bioRxiv - Cell Biology 2019Quote: ... and 2-Mercaptoethanol (BioRad #1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 2× loading buffer (Biorad, 1610768) was added to hairpin samples ...
-
bioRxiv - Microbiology 2020Quote: ... and 2-mercaptoethanol (Bio-Rad), heated at 100°C for 5 minutes ...