Labshake search
Citations for Bio-Rad :
51 - 100 of 2795 citations for 6H Thieno 2 3 b pyrrole 5 carboxylicacid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... pan B-Raf (OTI4B2, Bio-Rad), phosphorylated B-Raf (S729 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Vitamin B-12 (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... Microseal ‘B’ plate sealers (Bio-Rad) and iTaq Universal Probes Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% (v/v) anhydrous 2-mercaptoethanol (#1610710XTU, Bio-Rad, Hercules, CA, USA). The resulting mixture was then boiled for 15 min and then 35 µl of each sample was loaded into individual wells of 10–20% ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Immunology 2020Quote: ... and 100μL AP color reagent B (Biorad) was added to the plate at 100μL/well for 15 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2019Quote: Organotypic slices were biolistically transfected at 3-5 days in vitro(div) using a Helios GeneGun (Bio-Rad), bullets were prepared using PI4KIIα shRNA alone or in combination with either wild type or S9/51A shRNA resistant PI4KIIα ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... and vitamin B-12 (Mr 1,350) (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... which were sealed with Microseal ‘B’ Seals (BioRad). All experiments were run on a CFX96 Touch Real-time Detection system with a C1000 Touch Thermal cycler (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... which were sealed with Microseal ‘B’ Seals (BioRad). All experiments were run on a CFX96 Touch Real-time Detection system with a C1000 Touch Thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... Cover plate with Microseal ‘B’(Biorad, MSB-1001). Give the plate a quick spin to collect all liquid at the bottom (Sorvall or Allegra centrifuges ...
-
bioRxiv - Biochemistry 2021Quote: ... Plates were sealed with Micoseal ‘B’ seals (BioRad). Thermal melt analysis was performed in a QuantStudio 6 Flex RT-PCR device (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and covered by Microseal ‘B’ seal (Bio-Rad). qRT-PCR was run in the BIO-RAD CFX connect system ...
-
bioRxiv - Cell Biology 2024Quote: ... sealed with Microseal ‘B’ seals (Bio-Rad, MSB1001), and conducted in the CFX96 Touch Real-Time PCR Detection System (Bio-RAD ...
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% of the lysates were boiled with 2 x laemmli buffer (BIO-RAD, Hercules, CA, USA) and used as input ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates are sealed using optically clear microseal B (Biorad). Each assay is performed in technical duplicate for a total of four RT-qPCR wells per sample (fig ...
-
bioRxiv - Biochemistry 2022Quote: ... Buffer B supplemented with 0.05% Tween 20 (BIO-RAD) was used as a running buffer throughout SPR measurements ...
-
bioRxiv - Biophysics 2022Quote: ... sealed with a microseal B adhesive sealer (Bio-Rad) and centrifuged (1 min ...
-
bioRxiv - Cell Biology 2019Quote: ... and Magic red cathepsin B (MRC) (Bio-Rad ICT937) were used to stain lysosomes in the cells ...
-
bioRxiv - Genetics 2022Quote: ... Microseals ‘B’ were purchased from Bio-Rad (Hercules, CA). CELLSTAR black polystyrene clear bottom 96 well microtiter plates were purchased from Greiner Bio-One (Monroe ...
-
bioRxiv - Cell Biology 2023Quote: ... sealed with the Microseal ‘B’ seal (Bio-Rad, MSB1001), and was performed in the CFX96 Touch Real-Time PCR Detection System (Bio-RAD ...
-
bioRxiv - Microbiology 2019Quote: ... Relative fluorescence was measured at 5-minute intervals for 2 hours in a CFX96 system (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... to pH 8.88 first for 5 min at 95 °C followed by 60 °C for 3 h on a T100 Thermal Cycler (Bio-Rad) with the heated lid set to 105 °C ...