Labshake search
Citations for Bio-Rad :
51 - 100 of 4517 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and mixed with a one-third volume of 4×Laemmli protein sample buffer (cat. # 1610747, Bio-Rad). Following centrifugation at 20,000×g at 4℃ for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... and Quantity One 1-D analysis software (Bio-Rad). Band density was normalized to the background and statistically analyzed by Student’s t-test in Prism 9 software.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (30 µg) were run approximately one inch into a 4-15% bis-acrylamide gel (Bio-Rad) and processed for in-gel digestion as previously described (60) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were electrophoresed at 150V for one hour through 7.5% or 4-20% mini-PROTEAN TGX gels (Bio-Rad) and blotted at 300 mA for one hour onto PVDF membranes ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Zoology 2022Quote: ... sfRNA and 3’UTR were quantified together by RT-qPCR using the iTaq Universal Sybr green one-step kit (Bio-Rad) with primers previously designed [26] ...
-
bioRxiv - Plant Biology 2021Quote: ... At least 4-6 technical replicate RT-qPCR reactions were performed using iTAQ with ROX and SYBR (BioRad), and 20μL reactions were prepared as per the manufacturer recommendations ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated overnight at 4 °C with rabbit anti-chick IL-6 (Bio-Rad Laboratories, Inc., Hercules, CA) diluted 1:20 in incubation buffer ...
-
bioRxiv - Physiology 2024Quote: ... 6 μg of protein from each sample was loaded into a 4-20% Mini-PROTEAN® TGX gel (BioRad) and proteins were separated by size using electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... 4-20% gradient gels (BioRad) and transferred to 0.2 μm nitrocellulose membranes (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2023Quote: ... 4% low-melt agarose (BioRad) was prepared in 100 mM sodium cacodylate buffer and kept liquid at 70 °C until needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were boiled at 95 °C for 10 mins with 6×SDS sample buffer before loading onto 4–20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Systems Biology 2021Quote: ... and 6 μl for slow growing mutants with lower OD600) on Stain-Free gels (4-20%, CAT # 4568096, Bio-Rad, Tris/Glycine SDS Buffer (CAT # 161-0732 ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Cell Biology 2019Quote: ... and densitometric analysis was performed using the Gel Doc 2000 Gel Documentation System and Quantity One version 4 software (BioRad, CA, USA). The β-tubulin signal was used to normalize protein levels.
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (15 μg) were loaded on 4-15% 1 D polyacrylamide Mini-PROTEAN TGX Stain-Free gels (BioRad) and run in 1X Tris Glycine SDS buffer (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots densitometric analyses were performed using Quantity One 1-D software (Bio-Rad) and compared with that made by MCID.
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µl of the diluted DNA sample was added to 6 µl of a mixture containing SYBR Green Supermix (Bio-Rad) and gene-specific primers (0·4 µM total ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...