Labshake search
Citations for Bio-Rad :
51 - 100 of 5866 citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... boiled for 5 min and then resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... cells were stimulated with 5 μg/ml anti-Igκ plus anti-Igλ F(ab’)2 antibodies (BioRad). After 5 min of data acquisition ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL of Precision Plus Dual Xtra Protein Standards (2–250 kDa) were used (Bio-Rad Laboratories). Oligomerization patterns were visualized using silver staining.
-
bioRxiv - Molecular Biology 2020Quote: ... samples were boiled for 5 min and equal volumes were loaded onto a 4-15% gradient gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Physiology 2021Quote: ... Samples (5 μL) were then loaded on precast gradients (4-15%) SDS-polyacrylamide gels in duplicate (Bio-Rad Laboratories) and subjected to electrophoresis at 180 V for 40 minutes using pre-made 1x SDS-PAGE running buffer (Ameresco) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pH 8.3) running buffer by loading 5 μg sample onto 4-20% Mini-PROTEAN® TGXTM gels (Bio-Rad) with iBrightTM Prestained Protein Ladder (#LC5615 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µL of the supernatant was loaded into a 4−20 % Mini-PROTEAN-TGX gel (BioRad, Hercules, CA, USA), run at 165 V for 50 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/sample was loaded onto 4-15% gradient polyacrylamide gels (Mini-PROTEAN TGX Gels, Bio-Rad, 4561083), transferred (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... Total protein (5∼15 µg) was loaded and separated by 4–20% pre-made SDS-PAGE gels (#4568095, BioRad, Mini-PROTEAN TGX Stain-Free Precast Gels ...
-
bioRxiv - Neuroscience 2024Quote: ... Each sample (15 μg) was boiled for 5 min and applied on NuPAGE 4%– 12% Bis-Tris Gel (Biorad). The gel was transferred onto a nitrocellulose membrane ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were incubated for 5 minutes (tissue ≤ 40μm) or 10 minutes (tissue ≥ 100μm) in polyacrylamide (PA) solution [4% acrylamide/bis acrylamide (BioRad., 1610154), 60mM Tris HCl pH 8 (Corning ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml bed volume (0.8 × 4 cm) empty polypropylene column (BioRad) fitted with a two-way stopcock up to the fill line ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of protein (5–20 μg) were loaded into each lane and separated on 4–20% polyacrylamide tris glycine SDS gels (BioRad), then transferred to polyvinylideneifluoride membranes (BioRad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were boiled at 95 °C for 5 mins with 6xSDS sample buffer before loading onto 4-20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Neuroscience 2021Quote: ... A 1:5 dilution from serum samples was combined with 4 °C Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and heated at 100 °C for 10 min before loading into 12% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... 10 mM borate pH 10 was prepared at 5 μM and loaded onto a 4-20% Mini-Protean TGX pre-cast gel (BioRad). 10 μL of each folding sample was subsequently loaded onto the same gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then washed with IP lysis buffer three time and boiled in 25 ul of 2X SDS-loading buffer for 5 minutes and loaded into 4-15% polyacrylamide gels (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl; BioRad) and transferred onto Immun-Blot PVDF 0.2 µm (BioRad ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Cell Biology 2021Quote: Purified substrates and enzymes were centrifuged (16,000 g, 5 min, 4°C) before protein concentration was determined by Bradford assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were denatured by boiling in 1x Laemmli buffer at 95°C for 5 minutes and loaded on a 4–20% gradient gel (BioRad). PVDF membranes were used for proteins wet transfer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad). Membrane was blocked with 5% skim milk in TBST 1x on rocker for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were heated at 95°C for 5 minutes and loaded on 4-15% TGX gels (Bio-Rad, no. 4568083) in running buffer (25 mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01% bromophenol blue) and denaturated 5 min at 95°C before protein separation by SDS–PAGE on 4-15% precast gels (Biorad).
-
bioRxiv - Microbiology 2022Quote: ... pBAC-BoHV-4-A-revORF45HA and pBAC-BoHV-4-A-ΔORF45KanaGalK DNAs (5 μg) were electroporated in 600 μl DMEM high without serum (Biorad, Gene Pulser XCell ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 15 μg siRNA (5 μg from each siRNA) was transferred to a 4-mm cuvette (Bio-Rad) and 5-10×106 DCs were added in 200 μl OptiMEM and incubated for 3 min before being pulsed with an exponential decay pulse at 300 V ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were washed in 4 x 5 minutes in 0.2% TBS tween before incubating in Clarity™ Western ECL Substrate (BioRad) for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 min at 95 C and loaded onto an or 4-20% TGX stain-free polyacrylamide gels (Biorad), followed by standard western blotting procedures ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of protein (5 µg) were loaded into each lane and separated on 4– 20% polyacrylamide Tris glycine SDS gels (BioRad), then transferred to 0.45 µm PVDF membranes (Millipore Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 min at 95 C and loaded onto an or 4-20% TGX stain-free polyacrylamide gels (Biorad), followed by standard western blotting procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were boiled at 95 °C for 5 minutes and separated on precast 4-20% Criterion TGX gels (Bio-Rad). The competition of IA-rhodamine was analyzed by in-gel fluorescent signal using a ChemiDoc MP (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... boiled for 5 min at 95 °C and then loaded on 4–15% Mini-PROTEAN TGX Precast Gels (Bio-Rad). Gels were transferred onto polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... before heating at 95°C for 5 minutes and finally loaded onto 4-20% polyacrylamide gel (Bio-Rad, Cat # 4561094). Samples were then transferred to a PVDF membrane using the Trans-Blot® Turbo™ Transfer System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg of protein was boiled for 5 min at 95°C and then loaded on a 4-15% SDS gel (Biorad).
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
bioRxiv - Cell Biology 2021Quote: Cells lysates were separated on 4-2% gradient SDS-polyacrylamide gels (Biorad), transferred to polyvinylidene fluoride (Millipore ...