Labshake search
Citations for Bio-Rad :
51 - 100 of 6411 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were boiled at 95 °C for 5 mins with 6xSDS sample buffer before loading onto 4-20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Neuroscience 2021Quote: ... A 1:5 dilution from serum samples was combined with 4 °C Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and heated at 100 °C for 10 min before loading into 12% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... 10 mM borate pH 10 was prepared at 5 μM and loaded onto a 4-20% Mini-Protean TGX pre-cast gel (BioRad). 10 μL of each folding sample was subsequently loaded onto the same gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then washed with IP lysis buffer three time and boiled in 25 ul of 2X SDS-loading buffer for 5 minutes and loaded into 4-15% polyacrylamide gels (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl; BioRad) and transferred onto Immun-Blot PVDF 0.2 µm (BioRad ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Cell Biology 2021Quote: Purified substrates and enzymes were centrifuged (16,000 g, 5 min, 4°C) before protein concentration was determined by Bradford assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were denatured by boiling in 1x Laemmli buffer at 95°C for 5 minutes and loaded on a 4–20% gradient gel (BioRad). PVDF membranes were used for proteins wet transfer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad). Membrane was blocked with 5% skim milk in TBST 1x on rocker for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were heated at 95°C for 5 minutes and loaded on 4-15% TGX gels (Bio-Rad, no. 4568083) in running buffer (25 mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01% bromophenol blue) and denaturated 5 min at 95°C before protein separation by SDS–PAGE on 4-15% precast gels (Biorad).
-
bioRxiv - Microbiology 2022Quote: ... pBAC-BoHV-4-A-revORF45HA and pBAC-BoHV-4-A-ΔORF45KanaGalK DNAs (5 μg) were electroporated in 600 μl DMEM high without serum (Biorad, Gene Pulser XCell ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 15 μg siRNA (5 μg from each siRNA) was transferred to a 4-mm cuvette (Bio-Rad) and 5-10×106 DCs were added in 200 μl OptiMEM and incubated for 3 min before being pulsed with an exponential decay pulse at 300 V ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were washed in 4 x 5 minutes in 0.2% TBS tween before incubating in Clarity™ Western ECL Substrate (BioRad) for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 min at 95 C and loaded onto an or 4-20% TGX stain-free polyacrylamide gels (Biorad), followed by standard western blotting procedures ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of protein (5 µg) were loaded into each lane and separated on 4– 20% polyacrylamide Tris glycine SDS gels (BioRad), then transferred to 0.45 µm PVDF membranes (Millipore Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 min at 95 C and loaded onto an or 4-20% TGX stain-free polyacrylamide gels (Biorad), followed by standard western blotting procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were boiled at 95 °C for 5 minutes and separated on precast 4-20% Criterion TGX gels (Bio-Rad). The competition of IA-rhodamine was analyzed by in-gel fluorescent signal using a ChemiDoc MP (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... boiled for 5 min at 95 °C and then loaded on 4–15% Mini-PROTEAN TGX Precast Gels (Bio-Rad). Gels were transferred onto polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... before heating at 95°C for 5 minutes and finally loaded onto 4-20% polyacrylamide gel (Bio-Rad, Cat # 4561094). Samples were then transferred to a PVDF membrane using the Trans-Blot® Turbo™ Transfer System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg of protein was boiled for 5 min at 95°C and then loaded on a 4-15% SDS gel (Biorad).
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Microbiology 2020Quote: ... One or two micrograms of the concentrated viruses were heated at 95 °C for 5 min before being resolved on 4-20% SDS-PAGE (Bio-Rad) using the Novex™ Sharp Pre-stained Protein Standard (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... They were incubated at the room temperature for 5-10 min and they were placed inside a 4-mm cuvette (Bio-Rad). The cuvettes were pulsed using the BTX electroporator (300 V ...
-
bioRxiv - Biochemistry 2022Quote: ... and heated to 100 °C for 5 min and resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... lysates were cleared by centrifugation at 16000xg for 5 min at 4°C and the total protein concentration in the lysates was measured by Bradford protein assay (Bio-Rad). For western blot analysis 25 µg of each lysate was boiled for 5 min at 98°C (for the detection of LC3B and ATG9A samples were heated at 60°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... excess antibody subsequently removed by a further 4 washes in TBSTw for 5 minutes before detection with ECL Western blotting reagent (Bio-Rad) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 50 μg of neuronal lysate and corresponding mHTTex1 seed were boiled for 5 min with sample loading buffer and loaded into a 4-20 % polyacrylamide gel (SDS-PAGE, Criterion Bio-Rad) to detect monomeric endogenous HTT or by semi-denaturing detergent agarose (1.5% ...
-
bioRxiv - Microbiology 2020Quote: ... and boiled for 5 min prior to loading on 4-20% SDS-PAGE gradient gels (Mini-PROTEAN TGX precast gels; Bio-Rad). Precision Plus Protein Unstained Protein Standards (Bio-Rad ...
-
bioRxiv - Physiology 2021Quote: ... Protein aliquots were denatured in Laemmli sample buffer at 100°C for 5 min and then loaded (10– 15 μg protein per lane) on 4–20% Criterion TGX Stain-free gels (Bio-Rad) and run for 45 min at 200 V ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were boiled for 5 min and the proteins were separated in 4-20% Mini-PROTEAN TGX Precast Protein Gel (Bio-RAD) and electroblotted to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2022Quote: ... cell density was between 4-5 × 106 cells/mL with >95% viability as determined using a TC20 automated cell counter (Bio-Rad). Cells were diluted with warm Expi293 Expression Media to 2 × 106 cells/mL in 42.5 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated with primary and HRP-secondary antibodies in TBST buffer with 5% milk (RT for 1 hour or overnight at 4 °C) and revealed with an ECL solution (BIO-Rad) following manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were incubated at 95 °C for 5 minutes prior to being resolved on a 4 – 15% Mini-PROTEAN TGX Precast Protein Gels (Bio-rad) and transferred onto a methanol activated Immobilon-P PVDF membrane (Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... heated at 95 °C for 5 min and resolved on a 4–12% Criterion XT Bis-Tris Protein Gel (Cat. No. 3450125, Bio-Rad). Proteins on the gel were transferred to the PVDF membrane ...
-
bioRxiv - Developmental Biology 2022Quote: ... The suspended eggs and siRNA (5 μg/μl stock solution, in MilliQ) were transferred to a 4 mm cuvette (Bio-Rad) with a final volume of 200 μl and were gently mixed ...
-
bioRxiv - Microbiology 2021Quote: ... Binding reactions were incubated for 40 minutes at 37 °C then run on a precast 5% TBE acrylamide gel at 4 °C for 45 minutes at 100 V (Bio-Rad). After transfer to Biodyne B Modified Nylon Membrane (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second-dimension gel electrophoresis was performed in 1× TBE buffer containing 0.3 μg/ml of ethidium bromide at 6.0 V/cm for 5 hr at 4°C with buffer circulation in a Sub-cell GT electrophoresis system (Bio-Rad). DNA was transferred to Hybond-XL (GE Healthcare).
-
bioRxiv - Microbiology 2021Quote: ... proteins were denaturized in SDS-PAGE protein loading buffer for 5 minutes at 95°C and resolved by SDS-PAGE on 4-12% bis-tris Criterion XT Precast gels (Bio-rad), transferred to a PVDF membrane and blocked for at least 1h in 1% Casein blocking buffer (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... against the OAD buffer for 6h at 4 °C to remove the sucrose and then loaded on an EnrichQ 5/50 column (Bio-Rad) equilibrated with the ion-exchange buffer A (50 mM HEPES pH 7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal masses of protein (5 ug – 40 ug) were separated by 4—15% of SDS/ PAGE and were transferred onto nitrocellulose membranes (Bio-Rad) for protein blot analysis ...
-
bioRxiv - Biophysics 2022Quote: ... Digestion was confirmed by running 5 µL of digested or diluted samples on a 4-20% TGX Mini-Protean gradient gel (Bio-Rad), followed by staining with Gelcode Blue (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were boiled for 5 min at 95°C before separation on a gradient 4 to 20% sodium dodecyl sulfate (SDS)-polyacrylamide gel (Bio-Rad). Samples were then transferred to nitrocellulose membrane using standard methods for semidry transfer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... at either 95°C for 5 minutes or at 70°C for 10 minutes and resolved in a 4-15% Precast Gels (Bio-Rad, 12-well ...
-
bioRxiv - Microbiology 2024Quote: ... 20µg of protein samples were heated in 1X Laemmli buffer at 95°C for 5 min and loaded on pre-cast 4-20% SDS-polyacrylamide electrophoresis gel (Bio-Rad). For the RIP experiment ...