Labshake search
Citations for Bio-Rad :
51 - 100 of 3520 citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Neuroscience 2023Quote: ... Free floating sections were blocked with 3% donkey serum and incubated overnight with rat anti-CD68 (1:200, Bio-Rad). Aβ deposition and CD68 staining were both developed with a Vectastain ABC kit and DAB reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2023Quote: For VP protein analysis 3×109-1×1010 vg of purified AAV were mixed with 12.5 µl 4x Laemmli Sample Buffer (Bio-Rad, supplemented with 10% 2-mercaptoethanol ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of proteins at 10 µM mixed in a 3:1 ratio with 4X Laemmli Buffer Sample (Biorad) provided with 10% DTT ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bones were then decalcified by rocking in 19 % ethylenediaminetetraacetic acid (Biorad, 1610729) for 14 days at 4 °C with solution changes every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with Aminex Fast Acid Analysis and HPX-87H columns (Bio-Rad) at 55°C and 2 mM H2SO4 as the eluent at a flow rate of 0.5 ml min-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transferred to nitrocellulose membrane (Whatman Protran BA85, cat. No. 10401196) (25 V, 1 A, 3 0min using Trans Blot Turbo transfer system (Bio-Rad). Membrane was blocked with 5% milk and probed with anti-mAID (1:5,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA electrophoresis was performed at 200 V for 1 h and then RNA was transferred to a nylon membrane using MiniProtean 3 system (BioRad, USA). Transfer conditions were 100 V for 1 h at 4 °C in TBE buffer 1 × ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were washed 3 times in PBS and eluted in 40 μL 2X Laemmli Buffer with 1:20 β-mercapto-ethanol (BioRad) at 95°C for 5 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and incubated at 65°C for 3 mins before running 1% agarose-Etbr gel electrophoresis to detect the cleavage efficiency by ChemiDoc system (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... then incubated with ProSignal Pico Spray chemiluminescence substrate (Prometheus) for 1-3 minutes at room temperature and imaged using a ChemiDoc Imaging System (Bio-Rad). Contrast was occasionally adjusted to improve visualization of bands ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Immunology 2024Quote: ... After final wash and supernatant removal, 1x Loading Buffer (40 μL, 3:1 Lysis Buffer:4x Laemmli Loading Buffer (Bio-Rad)) was added to the sample and the sample boiled (10 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Microbiology 2021Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm, Bio-Rad) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total protein lysate concentrations were quantified using a bicinchoninic acid (BCA) assay (BioRAD) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... An organic acid column (Aminex HPX-87H 300 × 7.8 mm, Bio-Rad, USA) was employed for the analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein content was determined with a bicinchoninic acid reagent (Bio-Rad, Hercules, CA). Equal loading was verified in a twin run of electrophoresed individual strips of protein stained with Ponceau S (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1x Tris/acetic acid/EDTA (TAE) buffer (Bio-Rad, catalog no. 1610743) at 2.8 V/cm for 6 h 45 min with constant buffer recirculation ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...