Labshake search
Citations for Bio-Rad :
51 - 100 of 1639 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Each column then received 200 µL of ProteOn 1 M Ethanolamine hydrochloride pH 8.0 (BioRad, Cat. # 1762450) and was incubated for 4 hours to quench any remaining active site on the resin ...
-
bioRxiv - Pathology 2023Quote: Protein samples were denatured using buffer containing Tris-carboxyethyl phosphine hydrochloride (20x XT-Reducing Agent, BioRad-1610792) and separated based on molecular weight by electrophoresis in 4-12% gradient gels (Criterion™ ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... then 72°C for 7 min (BioRad T100 Thermocycler). PCR products were separated on a 2% agarose gel in TAE buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μL of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and RNase-free water for a final reaction volume of 15 μL in each well ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7×8.5 cm precut nitrocellulose membranes (BioRad, cat. #162-0146), at 4°C with magnetic stirring and an opposing cold-pack ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR was conducted using the QuantumStudio-7 (Bio-Rad). mRNA expression levels were quantified by real-time PCT using SYBR green fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... for 7 min using Trans Blot Turbo System (Bio-Rad). Filters were washed three times and blocked for 1 hour in Tris-Tween buffered saline (TTBS ...
-
bioRxiv - Neuroscience 2024Quote: ... we used Image Lab software (BioRad, Version 6.1.0 build 7) to analyze the total volume of bands of interest and subtract the volume of a membrane space where no bands were present (background) ...
-
bioRxiv - Biochemistry 2024Quote: ... on 7-8% handcast mini polyacrylamide gels (acrylamide [Bio-Rad, 1610146] ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was washed 3 times with PBS-T and developed with ECL (Biorad170-5060) for 2 min and imaged on ChemiDocTMMP (Biorad).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... for 7 min in a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with 3% BSA in TBST and incubated with mouse anti-His monoclonal antibody overnight in a cold room ...
-
bioRxiv - Immunology 2021Quote: ... and mouse anti-pig CD203a-FITC (clone PM18-7; Bio-Rad). Granulocytes were defined as 2B2+CD203a- ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were then transferred to a Minisize PVDF 7 membrane (BioRad) using a semi-dry transfer (TurboBlot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PV1s (7 μg) and molecular weight marker (Dual Color, Bio-Rad) were transferred from SDS-PAGE 16% gels onto nitrocellulose membranes (Amersham ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... For experiments performed using QS 7 Flex (TFS) and BioRad CFX384 (BioRad), Hard-Shell® ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 μL polyacrylamide (PA) solution containing 7% acrylamide monomer (Bio-Rad, Hercules, CA), 0.35% bisacrylamide crosslinker (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the Trans-Blot Turbo Transfer System (Bio-Rad, 7 mins at 20V).
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Densitometry analysis was carried out using Image Lab (v6.1.0 build 7, Bio-Rad, SG). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... and transferred for 7 minutes on a nitrocellulose membrane (Bio-Rad, Hercules, CA, 1620233) in XT transfer buffer (Bio- Rad ...
-
bioRxiv - Immunology 2024Quote: ... Blot images and bands were quantified using ImageLab software (version 6.10, build 7; BioRad).
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Biophysics 2023Quote: GAGs were purified with a column of 7 mm diameter and 10 cm length (BioRad) packed with Sephadex G25 resin (Sigma-Aldrich # G25150) ...
-
bioRxiv - Genomics 2024Quote: ... The membrane was first blocked with 7% nonfat dry milk (Bio-rad, catalog no. 1706404) in PBS for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...