Labshake search
Citations for Bio-Rad :
51 - 100 of 4366 citations for 3 2 Isopropylphenyl 1 propene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-α tubulin (YL1/2) (MCA77G, Bio-Rad; 1:1500). Secondary antibodies used were Alexa Fluor 488 goat anti-mouse IgG (H + L ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were resuspended in agarose insert buffer and mixed 1:1 with 2% low-melting agarose (Bio-Rad). Gel inserts were solidified at 4°C for overnight and were stored in agarose insert buffer until analysis ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
bioRxiv - Cancer Biology 2024Quote: Stable HUVECs were lysed in SDS containing 2% 1× Laemmli buffer (Bio-Rad) supplemented with 5% 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... and washed with TBST (2 × 1 min) and TBS (1 × 1 min) before imaging using Clarity western enhanced chemiluminescence substrate (Bio-Rad, cat. # 1705061). Membranes were always stained first with H3 (C-term ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Three replicas of 1.5μl of a 1:3 dilution of cDNA were amplified using SsoFast EvaGreen Supermix (BioRad) for FACS-sorted microglia and Power SYBR Green (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on the 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... incubated with goat α-rabbit 2° antibody conjugated to HRP (1:5000) (Bio-Rad) in TBS-T at room temperature (1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... The purity of 12mer arrays was confirmed using APAGE (2% acrylamide, 1% Biorad agarose) gels stained with SyBr Gold (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... 2× ddPCR supermix for probes (no dUTP) final concentration 1× (Bio-Rad Laboratories, USA), a 20× target primer/FAM-labeled probe mix ...
-
bioRxiv - Biochemistry 2021Quote: ... blots were incubated for 1-2 h at RT with an anti-rabbit HRP-conjugated secondary antibody (diluted 1 : 3,000, Bio-Rad) in TBST with 5% milk ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed again with 1x PBS-T (0.075 %) 3 times 10 minutes each and incubated with 1:1 ECL chemiluminescence solution (Clarity Western ECL, #170-5061, Bio-Rad Laboratories, Hercules, CA, USA). Signal was detected using an Amersham AI600 imager (Supplementary Table 5).
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Zoology 2020Quote: ... Samples were incubated in a 1:1 (w/v) ratio of 2× sample buffer (0.2M DTT, BioRad Laemmli Sample Buffer #1610737) at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-rat Ly-6B.2 alloantigen (1:100, MCA771GA, Bio-Rad Laboratories, Hercules, CA) for neutrophils ...
-
bioRxiv - Neuroscience 2020Quote: ... TBS-T) before incubation with HRP-conjugated secondary antibody for 2 hours (Biorad, 1:1000). After 3 times washes with 5 min intervals with TBS-T ...
-
Bacterial Polyphosphates Induce CXCL4 and Synergize with Complement Anaphylatoxin C5a in Lung InjurybioRxiv - Immunology 2022Quote: ... using 1-2 ng cDNA per sample complemented with iQ SYBR®Green Mastermix (BioRad) and specific forward and reverse primers at a concentration of 0.5 µM each ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-5 µg of target protein was resuspended in 2× Laemmli Sample Buffer (Bio-Rad) with adding 1:20 Beta-mercaptoethanol and 15 µL of the mixture was added onto Any kD™ Criterion™ TGX Stain-Free™ Protein gel (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Neuroscience 2023Quote: ... Free floating sections were blocked with 3% donkey serum and incubated overnight with rat anti-CD68 (1:200, Bio-Rad). Aβ deposition and CD68 staining were both developed with a Vectastain ABC kit and DAB reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2023Quote: For VP protein analysis 3×109-1×1010 vg of purified AAV were mixed with 12.5 µl 4x Laemmli Sample Buffer (Bio-Rad, supplemented with 10% 2-mercaptoethanol ...