Labshake search
Citations for Bio-Rad :
51 - 100 of 1522 citations for 2 Ethyl 3 ethyl d5 pyrazine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Microbiology 2024Quote: ... 1 % 2-Mercaptoethanol (Biorad)) and bead beat for 2 minutes at maximum speed (Biospec Mini Beadbeater) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Neuroscience 2022Quote: ... and analyzed with Opticon Monitor 3 and GeneX (BioRad) software ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed in 3% paraformaldehyde (Bio-rad) in PBS for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... from a 3% low range agarose gel (BioRad, 1613107) to remove adapter dimers.
-
bioRxiv - Biophysics 2024Quote: ... 0.2% (w/v) Bio-Lyte 3/10 Ampholyte (BioRad), 1% bromophenol blue) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Immunology 2021Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Immunology 2022Quote: ... then blocked with 2% blocking buffer (PBS + 2% non-fat dry milk (Bio-Rad) + 2% goat serum + 0.05% Tween-20 ...
-
bioRxiv - Genomics 2020Quote: ... + 2 μl SilentFect (Bio-Rad) was incubated at RT for 5 min before mixing with 2 μl siRNA (20 μM stock ...
-
bioRxiv - Cell Biology 2020Quote: ... 2× loading buffer (Biorad, 1610768) was added to hairpin samples ...
-
bioRxiv - Microbiology 2020Quote: ... and 2-mercaptoethanol (Bio-Rad), heated at 100°C for 5 minutes ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... and MOMA-2 (Bio-Rad). Plaque size was analyzed by ORO staining to provide contrast ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mm cuvette (Bio-Rad). The mixture was recovered for 2-3 h in 1 mL of NB medium at 28℃ and then cultured for 2 h after adding aTc to a final concentration of 200 μg/mL ...
-
bioRxiv - Genomics 2023Quote: ... 0.128mM 2-Mercaptoethanol (BioRad 1610710XTU), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF) ...
-
bioRxiv - Microbiology 2022Quote: ... + 2-mercaptoethanol (Bio-Rad #1610710) directly to the cell monolayer followed by incubation at 95°C for 15 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... 2% bis-acrylamide (Bio-Rad), and fluorescent beads (yellow or Texas red with ~0.5 μm diameter ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 µl SilentFect (Bio-Rad) was incubated at room temperature (RT ...
-
bioRxiv - Genomics 2024Quote: ... 2% (Bio-Rad, 161-0142); Ammonium persulfate (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... Biobeads SM-2 (Bio-Rad) were hydrated by washing them once in methanol ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2× Laemilli Buffer (Biorad). Lysates were heated for 5 min at 96 °C and resolved on an 8–10% SDS-acrylamide gel (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... Plates were blocked with 3% nonfat dry milk (BioRad, P1379) in 1xPBS for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 was performed using an iCycler thermocycler (Bio-Rad laboratories) with a TaqMan RT-PCR Master Mix (Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2022Quote: ... on 3 technical replicates using PCR SYBR GreenSuperMix (1725261, BioRad) and primers listed in Table S1 ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Pathology 2024Quote: ... plus 0.02% v/v pI 3–10 ampholytes (Bio-Rad). IEF was performed using 11 cm strips ...
-
bioRxiv - Physiology 2024Quote: Native-PAGE gels (3% acrylamide:bis-solution 19:1 (BioRad, 1610144)/0.08% ammonium persulfate/0.006% tetramethylethylenediamine (TEMED)/1X TBE ...
-
bioRxiv - Biophysics 2024Quote: ... Immobilized pH gradient (IPG) (pH 3–10) strip (ReadyStrip, BioRad) was loaded with proteins dissolved in 125 μl of rehydration buffer and passively rehydrated overnight at 25 °C ...