Labshake search
Citations for Bio-Rad :
901 - 950 of 2653 citations for Mouse Anti Cholera Toxin Beta Subunit Antibody E10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... After 5 washes with PBS1X-Tween 0,05% an anti-mouse IgG (H + L)-HRP Conjugate (Biorad) diluted 1:2000 in PBS1X-Tween 0,05% was added for 1h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 1:5,000 goat anti-mouse IgG (H+L)-HRP (Bio-Rad, catalog number 1706516) in 3% milk in PBS-T and developed as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... For immunohistochemistry (IHC) experiments following primary antibodies were used: IgG anti-human CD3 antibody (1:200, clone CD3-12, Bio-Rad) and anti-PCNA antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... secondary antibodies were incubated with the PVDF membrane for 1 hour at room temperature (Goat anti-rabbit antibody, BioRad, 1:3000). Then ...
-
bioRxiv - Microbiology 2020Quote: ... anti-GFP antibody was used and bound primary antibody was detected using anti-rabbit IgG-HRP secondary antibody following visualization with the Clarity™ Western ECL Substrate (BioRad) and subsequent detection in a ECL Chemocam Imager (Intas Pharmaceuticals Limited) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by horseradish peroxidise-conjugated secondary antibodies anti-rabbit (Bio-Rad 170–6515), anti-mouse (Bio-Rad 170–6516) ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies were goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Plant Biology 2019Quote: ... A secondary goat anti-rabbit horseradish peroxidase antibody (Bio-Rad Laboratories, Hercules, CA) was used at a 1:2,500 dilution For Supplemental Figure S4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated in goat anti-rabbit IgG horseradish peroxidase secondary antibody (1:5000, BioRad) for 2 hours at room temperature and then washed again with TBST prior to imaging on a BioRad ChemiDoc XRS+ imaging system using enhanced chemiluminescence (Pierce Supersignal West Pico) ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a secondary antibody (goat anti-rabbit HRP, Bio-Rad, AB_11125142; 1:2,000) were used in these experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... Secondary antibodies used were StarBright Blue 700 goat anti-rabbit IgG (12004161, BioRad), StarBright Blue 700 goat anti-mouse IgG (12004158 ...
-
bioRxiv - Cell Biology 2021Quote: ... The secondary antibody was ordered from Biorad (Goat anti-Rabbit IgG (H+L)-HRP Conjugate #172-1019) ...
-
bioRxiv - Microbiology 2022Quote: ... membranes were treated with secondary antibody goat anti-rabbit IgG-HRP (Bio-Rad) at a concentration of 1:3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Species-specific anti-IgG antibodies conjugated to HRP (Bio-Rad, Richmond, CA, USA) or IRDye 800CW and IRDye 680RD secondary antibodies (LI-COR Biotechonology ...
-
bioRxiv - Cancer Biology 2020Quote: ... lung sections were stained with anti-ECFP antibody (1:100, #AHP2986, Bio-Rad) and Alexa Fluor 488 goat anti-rabbit secondary antibody (1:1500 ...
-
bioRxiv - Cell Biology 2019Quote: Secondary antibodies conjugated to horseradish peroxidase (HRP): Goat anti-rabbit (BioRad #170-6515), Donkey anti-mouse (Jackson Immunoresearch Laboratories 713-035-147) ...
-
bioRxiv - Cell Biology 2021Quote: ... prebound with 5-10 µL anti-V5 antibody (SV5-Pk1, BioRad Cat# MCA1360G) and washed once with PBS before incubation with supernatant (4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The secondary antibody was ordered from Biorad (Goat Anti-Rabbit IgG (H+L)-HRP Conjugate #172-1019) ...
-
bioRxiv - Neuroscience 2019Quote: ... to which rabbit anti-PGRN antibody-conjugated Affi-Gel 15 (Bio-Rad Laboratories) or GFP-Trap beads were added ...
-
bioRxiv - Biochemistry 2022Quote: ... The secondary antibodies were ordered from Biorad (Goat Anti-Rabbit IgG (H+L)-HRP Conjugate #172-1019) ...
-
bioRxiv - Plant Biology 2022Quote: ... The secondary antibody Goat Anti-Rabbit IgG (H + L)-HRP (1706515, Bio-rad) was used in combination with α-PDX3 at a dilution of 1:3000 and α-NR at a dilution of 1:10000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Microglia was stained with rat monoclonal anti-CD68 antibody (1:100, Bio-Rad) and with a rabbit monoclonal anti-Iba1 antibody (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated in primary antibody (rat anti-MBP, BioRad, 1:200 dilution) for 24 hours at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The secondary antibodies were ordered from Biorad (Goat Anti-Rabbit IgG (H+L)-HRP Conjugate #172-1019) ...
-
bioRxiv - Cell Biology 2023Quote: ... and a goat anti-rabbit secondary antibody coupled to horseradish peroxidase (HRP) (BioRad). For V5-tagged proteins ...
-
bioRxiv - Microbiology 2023Quote: ... and antibody detected with goat-anti-rabbit HRP (Bio-Rad, 1706515, 1:5000).
-
bioRxiv - Plant Biology 2023Quote: ... with goat anti-rabbit HRP secondary antibody (1:3000, Bio-Rad #170-5046). Membranes were developed using the SuperSignal West Pico Chemiluminescent Substrate kit (Fisher #PI34578 ...
-
bioRxiv - Biophysics 2023Quote: ... The motility surface was coated with 0.8% anti-tubulin antibody (BioRad YL1/2) in BRB-80 buffer for 5 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... An anti-rabbit IgG (H&L) (GOAT) antibody that was peroxidase conjugated (BioRad) was used as the secondary probe ...
-
bioRxiv - Biochemistry 2024Quote: ... Secondary antibodies used were either anti-rabbit (170-6515 Bio-Rad; 1:3000) or ECL anti-mouse (NA931 Cytiva ...
-
bioRxiv - Cell Biology 2024Quote: ... or rat monoclonal anti-CD11b antibody (1:1000; BioRad, catalogue# MCA711G, lot# 0614) in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Binding of the anti-NTD antibody was detected using a goat anti-human kappa light chain conjugated to horseradish peroxidase (HPR) (BioRad). To normalize for the amount of the bound probes ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by addition of primary antibodies at 4 °C overnight with rotation (mouse anti-ϕ3-actin [Proteintech, 66009-1-Ig], 1:1000, and rat anti-χξ-tubulin [YOL1/34, MCA78G, Bio-Rad], 1:1000). The specimen was washed three times with PBST and incubated with secondary antibodies (anti-mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% dry non-fat milk in PBST and probed using PRP8a antibody (1:500) and an HRP coupled anti-Rabbit secondary antibody (Biorad, 1:10000). All antibodies were diluted in 1% dry nonfat milk in PBST ...
-
bioRxiv - Microbiology 2021Quote: ... Secondary antibodies were matched to the primary antibody and included HRP-conjugated goat anti-rabbit IgG (Bio-Rad Laboratories, Hercules CA, #1706515), goat anti-mouse IgG (Bio-Rad #1706516) ...
-
bioRxiv - Immunology 2020Quote: ... RBD-specific antibody titres in oral and nasal swab fluids were determined by ELISA as detailed above except that the conjugated secondary antibody was replaced with either goat anti-porcine IgG HRP (Bio-Rad Antibodies) at 1:20,000 dilution in PBS with 1% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... followed by secondary HRP- conjugated goat anti-mouse IgG(H+L) (1:10,000 dilution; Bio-Rad, USA), and then developed using the enhanced chemiluminescence procedure (Pierce ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated for at least 16 hours at 4°C with either mouse monoclonal anti-His (1:2,000; AD1.1.10, Biorad) or mouse anti-RNA pol (1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-mouse (#176516; 1:10,000 for Western blot) was from Bio-Rad. Alexa Fluor-conjugated goat antibodies against mouse IgG (1:500 for IF ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed before incubation with 1:2,500 goat anti-mouse StarBright™ Blue 700 (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: Membranes were subsequently probed with horseradish peroxidase (HRP)-conjugated goat anti-mouse or -rabbit IgG (Bio-Rad), diluted 1:5000 in 5% (w/v ...
-
bioRxiv - Bioengineering 2019Quote: ... Blots were incubated the following day with 0,33μg/ml Goat-anti-rabbit or -mouse HRP (Bio-Rad) in blocking buffer for 1h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse anti-MHC Class I RT1A (#MCA51G, 1:100, clone: OX-18, 1:100, Bio-Rad). Sequential imaging was performed on an Olympus FluoView confocal laser-scanning microscope (FV1200 ...
-
bioRxiv - Cell Biology 2019Quote: ... The secondary antibodies used for Western blotting were goat ⍰ -mouse IgG HRP conjugate (170-6516 from Bio-Rad; 1:2000) and goat ⍰ -rabbit IgG HRP conjugate (170-6515 from Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... HRP-conjugated secondary antibodies were diluted 1:10000 and 1:2000 for polyclonal Goat-α-Mouse (Bio-Rad, 170-6516) and Goat-α-Rabbit HRP (Dako ...