Labshake search
Citations for Bio-Rad :
851 - 900 of 5157 citations for PCR Tubes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... the QX200™ Droplet Digital™ PCR System (BIORAD) was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... on a CFX Connect Real-Time PCR machine (Biorad). The following primers for Fbxo7 (5’-CGCAGCCAAAGTGTACAAAG ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR were run on either a T100 (Bio-rad) or a SimpliAmp (Life Technologies ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... an integrated PTC-200 PCR machine (Bio-Rad Laboratories), stacks and hotels for microplates ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... The C1000 Real-Time PCR instrument (Bio-Rad, USA) was used for qRT-PCR ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR reactions using SsoFast EvaGreen Supermix (Bio-Rad) were performed in a CFX384 real time PCR system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Molecular Biology 2019Quote: ... using the iQ5 real time PCR system (Bio-Rad) starting with activation at 95°C for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Genetics 2019Quote: ... Quantitative PCR was performed using SYBR green (Bio-Rad) to access the frequency of deletion and inversion of the target sequences in bulk cell populations ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ( total volume ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed using SYBR green reagents (BioRad) and the ΔΔCT method (Applied Biosystems 1997) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a CFX Connect Real-Time PCR thermocycler (Biorad) Relative quantitation was calculated with the 2-ΔCt method where relative enrichment over the adjusted DNA input was used for data representation.
-
bioRxiv - Cancer Biology 2021Quote: The QX200 Droplet Digital PCR System (Bio-Rad Laboratories) was used for absolute quantification of mRNA expression in MCC tumor ...
-
bioRxiv - Cell Biology 2021Quote: ... prior to real time PCR (iCycler; BioRad, Hercules, CA). 25-μl amplification reactions contained primers (0.5 μM) ...
-
bioRxiv - Bioengineering 2021Quote: ... SYBR-Green PCR Master- mix (Bio-Rad, Hercules, CA) was used for qRT-PCR experiments on a Step-One Real-time PCR System (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: The QX200 Droplet Digital PCR (ddPCR) system (Bio-Rad) was used to provide absolute measurements of C9orf72 mRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... using the SYBR-Green PCR Master Mix (Bio-Rad). Quantitative PCR was performed in triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... a Mycycler™ Thermal Cycler PCR system (BioRad, USA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... on a MyiQ™ Real time PCR system (Biorad). The data generated by qPCR assays were normalized using the average value of the HBSS treatment control group.
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Plant Biology 2020Quote: ... in a CFX96 Real-Time PCR system (Bio-Rad) as described (Zhou et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and 12.75 µL of SYBR PCR master mix (BioRad) was used to perform Real-time quantitative PCR using iQPCR real-time PCR instrument (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cancer Biology 2020Quote: ... on the CFX384 RT-PCR detection system (Bio-Rad). Isoform-specific primers sequences and housekeeping gene primers are shown in the Supplement Table 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and subjected to droplet digital PCR (ddPCR, Bio-Rad) to assess chromosome 21 copy number variations ...
-
Mitochondrial and metabolic remodeling in human skin fibroblasts in response to glucose availabilitybioRxiv - Cell Biology 2021Quote: ... in a CFX96 real time-PCR system (Bio-Rad), with the primers defined in Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... on the Real-Time PCR Systems (CFX96, Bio-Rad, USA ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR data was analyzed using CFX Maestro (Biorad) qPCR analysis software and graphed using Prism (GraphPad ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Cell Biology 2022Quote: ... using the SYBR-Green PCR Master Mix (Bio-Rad). Primers used for QPCR are listed in Supplemental.Table 1.
-
bioRxiv - Biochemistry 2022Quote: ... with SYBR® GREEN PCR Master Mix (Bio-Rad) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX96 Real Time PCR System (Bio-Rad) to measure FGFR2-Full ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). The data were analyzed by the comparative threshold method ...
-
bioRxiv - Immunology 2022Quote: ... A 96-well PCR plate (Cat#: MLL9601, Bio-Rad) was used for the qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... in the CFX Real-Time PCR system (Bio-Rad), courtesy of the UCLA Virology Core ...
-
bioRxiv - Microbiology 2020Quote: ... with the CFX384 Real-Time PCR System (Bio-Rad), and fold changes were calculated to determine the relative expression levels.
-
bioRxiv - Physiology 2020Quote: ... real-time detection method (BioRad MyIQ RT-PCR, Thermo).
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... on CFX96TM Real-Time PCR Detection System (Bio-Rad). The cDNA was added to qPCR buffer Master-mix ...
-
bioRxiv - Immunology 2020Quote: ... into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CFX96 Real-Time PCR detection system (Bio-Rad Laboratories), or CFX384 Real-Time PCR detection system (Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed on the CFX96 (Bio-Rad). The expression of VEGF (F ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR Green PCR technology (EVAGreen, Bio-Rad, California, USA) was used with specific primers designed (sequences are reported in Supplemental Material ...