Labshake search
Citations for Bio-Rad :
851 - 900 of 8660 citations for Glutathione Fluorescent 384 Well Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Real-Time Detection System (Bio-Rad) in reaction volumes of 15 μl under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and CFX96 Touch Real-Time PCR Detection System (Biorad). The primer set for qPCR is ‘GGGGTGCTATCAGAGGCATC’ and ‘TAGGACCCTTGGTACCGGAG’.
-
bioRxiv - Physiology 2022Quote: ... Detection was performed on a ChemiDoc system (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used and quantification was performed with the DDCt method ...
-
bioRxiv - Cell Biology 2022Quote: ... The CFX96 Touch Real-Time PCR Detection System (Biorad) was used ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chemiluminescent detection was performed using ECL substrate (BioRad; #1705060).
-
bioRxiv - Cancer Biology 2023Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad). The specific primers for qPCR are listed in Supplemental Table S5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a CFX384 RT-PCR detection system (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... CFX Connect Real-Time PCR detection system (Bio-Rad) was used for measurement and analysis.
-
bioRxiv - Molecular Biology 2023Quote: ... on a CFX384 Real-Time PCR Detection System (BioRad) using the following thermal cycling conditions ...
-
bioRxiv - Genomics 2023Quote: ... and the Immun-Star AP detection system (Bio-Rad). The following antibodies were used for detection ...
-
bioRxiv - Microbiology 2023Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... Bands were visualized by chemiluminescence detection reagents (BioRad, #1705061) and imaged using a FusionFX Chemiluminescence Imager System (Vilber) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with CFX-96 Real-Time PCR Detection System (BioRad). The primers used in this study targeting histone H4C5 are ...
-
bioRxiv - Physiology 2023Quote: ... was used for the detection with ChemiDoc (Bio-Rad). Densitometric analysis of immunoblots was performed using Image Lab software (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... using a chemiluminescence detection reagent (ECL Clarity, Bio-Rad). Primary antibodies used are anti-phosphothreonine polyclonal antibody (9381 ...
-
bioRxiv - Plant Biology 2023Quote: ... The SFX96 TouchTMReal-Time PCR Detection System (Bio-Rad) was used for RT-qPCR performance ...
-
bioRxiv - Cancer Biology 2023Quote: ... An enhanced chemiluminescence detection system (ECL) and Chemidoc (BioRad) were used to develop the signal from HRP-conjugated secondary antibodies.
-
bioRxiv - Cancer Biology 2023Quote: Detection was performed using the iQ5 QPCR apparatus (Biorad), using IQ green super mix (Biorad) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and CFX Real-Time PCR Detection System (Bio-Rad). The data were analyzed by CFX Maestro qPCR Analysis Software (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... using ClarityTM western ECL detection system (Biorad #170-5061).
-
bioRxiv - Physiology 2024Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). The mRNA expression level of all genes was normalized to the reference gene rps12 or gapdh ...
-
bioRxiv - Developmental Biology 2024Quote: ... using CFX96TM Real-Time PCR Detection System (Bio-Rad). Transcript levels were normalized against Rplp0 expression ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... with CFX connect RT-PCR detection system (Bio-Rad).
-
bioRxiv - Physiology 2024Quote: ... and the CFX96 Real-Time PCR detection system (Biorad). Primer sequences are listed in S1 Table ...
-
bioRxiv - Immunology 2023Quote: ... and a CFX96 Real-time Detection System (Bio-Rad) were used to run the qPCR reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Enhanced chemiluminescence (ECL) detection reagents were ordered from Biorad.
-
bioRxiv - Molecular Biology 2023Quote: ... on a CFX96 Real-Time PCR Detection System (BioRad).
-
bioRxiv - Biophysics 2023Quote: ... An IQ5 Multicolor RT PCR Detection System (BioRad, USA) was used for gene expression analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... CFX96 Touch Real-Time PCR Detection System (Bio-Rad) was used to measure probes fluorescence and CFX Manager 3.1 software (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... in a CFX96TM Real-Time PCR Detection System (Biorad). Cq values were normalized to levels of Ywhaz using the ΔΔ-Ct method ...
-
bioRxiv - Microbiology 2023Quote: ... on a CFX96 real-time PCR detection system (BioRad) as described previously (32 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by enhanced chemiluminescence (ECL) detection (Bio-Rad, 1705060) using LAS-3000 mini (Fujifilm ...
-
bioRxiv - Cancer Biology 2024Quote: ... and detected through the Chemidoc detection system (Bio-Rad). Densitometric quantitation of raw images was obtained with Fiji software (Image J ...
-
bioRxiv - Biochemistry 2022Quote: ... 10μL of each time point were mixed with RNA loading dye and heated to 95°C before loading on a 1.0 cm well PAGE casting plate (Bio-Rad Laboratories, Mississauga, ON, Canada). Samples were run on a 7.5% Urea PAGE gel for 30 minutes at 300V in 0.5X TBE buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... XP2OS cells were transfected with 200 ng of plasmid containing the XPA VUS of interest or wild-type XPA as well as the FM-HCR reporter plasmids using the Gene Pulser MXCell Plate Electroporation System (Bio-Rad Laboratories #165-2670). Plate electroporation was performed at 260 V ...
-
bioRxiv - Cell Biology 2022Quote: ... Transcript analysis by qRT-PCR were performed using 2× ChamQ Universal SYBR qPCR Master Mix (Viazyme Biotech Co., Ltd., Nanjing, China) and a CFX96-C1000 96-well plate thermocycler (Bio-Rad, Hercules, CA, USA), the 18S rRNA was used as a reference gene25 ...
-
bioRxiv - Biophysics 2023Quote: ... Formazan crystals formed after 3 h in each well were dissolved in 150 μL of DMSO and the plates were read immediately in a microplate reader (BIO-RAD microplate reader-550) at 570 nm ...
-
bioRxiv - Molecular Biology 2024Quote: qPCR was performed on a Bio-Rad CFX96 apparatus in Hard-Shell® 96-well PCR low-profile plates (Bio-Rad, cat. no: HSP9601) with Optical Microseal ‘B’ PCR Plate Sealing Film (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genes were analysed by quantitative real-time PCR in a CFX-384 Real-Time PCR instrument (BioRad) in triplicate with at least three independent biological replicates using SYBR premix EX Taq (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR was performed using the Bio-Rad CFX-384 qPCR instrument (Bio-Rad, Hercules, CA, USA) using TaqMan Universal Master Mix II ...
-
bioRxiv - Cell Biology 2022Quote: ... and then quantitative PCR (qPCR) was performed using a qPCR machine (BioRad CFX 384 Real-Time System). Results were normalized to Lamin A/C for both human cells and mouse cells ...
-
bioRxiv - Genetics 2024Quote: ... The ddGBS libraries were quantified through RT-PCR on the CFX 384 Touch Real-Time PCR (BioRad) equipment using a KAPA Library Quantification kit (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR was carried out using a CFX Opus 384 Real-Time PCR System (Bio-Rad). Relative expression was calculated using the reference gene AT2G43770 ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was incubated at 37°C for 30 minutes then left to cool for 10 minutes before adding 6 μL of 0.2% 2-mercaptoethanol in SDS-page loading dye.38 Samples were then heated to 94°C for 2 minutes and added to the wells of a pre-cast 12% polyacrylamide gel (Bio-Rad). The gel was run for 45 minutes at 120 V in running buffer (25 mM Tris ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were added to the control wells without cells (Lanes 1 and 12) ranging from 0.125 – 2 mg/ml (BioRad 500-0202) and treated with formalin and NaOH at the same concentrations as the cells ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 50 µL/well of 2 µg/mL of mouse anti-bovine IFN-γ mAb (CC330 Bio-Rad Antibodies) diluted in carbonate coating buffer (pH 9.6 ...