Labshake search
Citations for Bio-Rad :
851 - 900 of 4878 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Proteins were visualized with goat anti-mouse or goat anti-rabbit IgG secondary antibodies (1:5000) diluted in 2% Omniblot milk (AmericanBio) in 1X TBST using a chemiluminescence detection system (BioRad ChemiDoc MP).
-
bioRxiv - Biophysics 2023Quote: ... The mixture was incubated for 1-2 h at 4 °C and incubated overnight with pre-washed bio-beads (Bio-Rad Laboratories) at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Protein lysates were boiled in loading buffer [1:9 ratio of 2-mercaptoethanol:4x Laemmli Sample Buffer (Cat.#1610747; Bio-Rad Laboratories)] for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transfer buffer was prepared as a 1X final solution by mixing 7:2:1 of ddH2O: methanol: 10X Tris/Glycine Transfer Buffer (Bio-Rad #1610734). Following transfer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Plant Biology 2020Quote: ... One microgram of total RNA was reverse transcribed to complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (Biorad, Hercules, California) in a 20 μL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... The gel was stained after the electrophoresis with SYBR Safe dye (10000x) and visualized using Quantity One analysis software (Bio-rad).
-
bioRxiv - Microbiology 2021Quote: ... the membranes were washed 3 times with 1 x TBS-T and antibody binding was detected in a BioRad Versa Doc System with the Quantity One software (BioRad, Germany) by chemiluminescence using the Clarity Western ECL Substrate (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were washed thrice with TBS-T before incubation for one hour at room temperature with secondary antibodies (horse radish peroxidase goat anti-mouse or anti-rabbit; Bio-Rad), all at 1:5000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... ZIKV RNA was quantified by TaqMan one-step qRT-PCR using a CFX96 Touch real-time PCR detection system (Bio-Rad). Genome copies per mL of serum on a log10 scale was determined by comparison with a standard curve generated by using serial 10-fold dilutions of a ZIKV plasmid and previously reported primers ...
-
bioRxiv - Genetics 2020Quote: cDNA synthesis was performed with one μg of total RNA in 20 μl reactions using the iScript Reverse Transcription Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Additional one-ml samples were used for total protein determination using the Bio-rad Protein Assay kit (Bio-rad, CA, USA). β-galactosidase assays were performed as described previously (38) ...
-
bioRxiv - Microbiology 2021Quote: ... using the primer-probe mix from the 2019-nCoV RUO kit (IDT) with iTaq Universal Probes One-Step kit (Bio-Rad). The 2019-nCoV_N_Positive Control plasmid (IDT ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SYBR Green qPCR was performed using a ViiA7 (A&B Biosystems, Waltham, MA) with iTaq Universal SYBR Green One Step Kit (BioRad, #1725151) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... All gene transcripts were quantified by quantitative PCR using qScriptTM One-Step qRT-PCR Kit (Quanta Biosciences, #95057-050) on CFX96 real-time PCR system (Bio-Rad). Primer sequences for qPCR were as follow ...
-
bioRxiv - Neuroscience 2022Quote: One ng of total RNA was used for single-tube reverse transcription (RT) and ddPCR using the One-Step RT-ddPCR Advanced kit (Bio-Rad). Droplets were generated and subsequently analyzed using the QX100 system (Bio-Rad ...