Labshake search
Citations for Bio-Rad :
851 - 900 of 1368 citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Slot blot was performed using 1.5 ng of gDNA that was denatured in 400 mM NaOH/10 mM EDTA and blotted onto nitrocellulose membrane (BioRad) in duplicate for dsDNA and 5mC DNA using a slot blot apparatus (BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were eluted by heating the beads at 95°C for 5 min in Laemmli Sample Buffer (1610747, Bio-Rad) with 50 mM DTT followed by magnetic separation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then washed with IP lysis buffer three time and boiled in 25 ul of 2X SDS-loading buffer for 5 minutes and loaded into 4-15% polyacrylamide gels (BioRad).
-
bioRxiv - Cell Biology 2019Quote: ... were boiled for 5 min and then loaded into 10% Mini-Protean TGX (Tris-Glycine eXtended) Stain-Free precast Gels (Biorad). Electrophoresis was performed in a buffer containing 25 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Membranes were washed using tris-based saline buffer solutions with 0.1% tween-20 (TBST) and blocking solutions were prepared using 5% w/v western-blot grade dry milk powder (Biorad). Membranes were blocked with blocking buffer for 1 hour and washed between incubations for 5-10 mins (3x) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein from the 5% of beads was eluted by boiling the beads in Laemmli sample buffer supplemented with BME (BioRad) and 2 mM biotin at 90°C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl; BioRad) and transferred onto Immun-Blot PVDF 0.2 µm (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 ng of cDNA was analyzed with isoform-specific droplet digital PCR assays and ddPCR Supermix for probes (Bio-Rad). Primers and probes (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR reaction was carried out in 10 μl volume with 5 μl of 2X iTaq Universal Sybergreen Supermix (BioRad), 500 nM of forward and reverse primers (for promoter ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were then denatured in 2X Laemmli at 95°C for 5 minutes and run in Mini-PROTEAN Precast Gels (BioRad) and transferred onto membranes using Trans-Blot Turbo ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 57 DNA from whole mosquitoes was extracted using 200 µL of 5% Chelex 100 Resin (Bio-Rad Laboratories, Hercules, CA) and 3 μL of Proteinase K (20 mg/ mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... the HRP substrate (GE Helathcare) was applied to the membrane for 5 minutes and the chemiluminescence was read on Chemidoc (Biorad).
-
bioRxiv - Genetics 2020Quote: ... The membrane was washes in TBS-T three times and incubated 5 min with Clarity Western ECL Substrate (#1705061, Biorad) in order to detect proteins immunoblotted signals at Alliance LD4 (UVItec Cambridge ...
-
bioRxiv - Molecular Biology 2019Quote: ... The slide was washed in TBS-T (4x 5 min) and visualized using SuperSignal West Pico chemiluminescent substrate (Pierce) and a ChemiDoc MP System (BioRad). Signal intensity normalization was performed using Array Analyze Software (Active Motif).
-
bioRxiv - Biochemistry 2020Quote: ... The samples were heated at 95°C for 5 min and separated on a 12% Bis-Tris SDS-PAGE gel (Biorad).
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 or 10 μL of the supernatant were resolved on an Any kD TGX Stain-Free protein gel (4568126, BioRad) alongside a Chameleon Duo Pre-Stained Protein Ladder (928-60000 ...
-
bioRxiv - Biophysics 2019Quote: ... Residual Ca2+ from this solution was removed by passing 100 mL of TLK buffer over 5 g of pH-neutralized Chelex 100 resin (BioRad) in a column three times at a flow rate of ~3 mL/min ...
-
bioRxiv - Molecular Biology 2021Quote: ... After centrifugation (50 x g for 5 min) the Ni-NTA agarose beads were transferred to an empty Bio-Spin Chromatography column (Biorad). The column was extensively washed with 20 CV (column volume ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were diluted into 5 ml 1X PBS and sorted and analysed with a S3e(tm) Cell Sorter and ProSort(tm) Software (BioRad). Fluorescence intensities of cells were measured using 488 nm and 561 nm lasers ...
-
bioRxiv - Biochemistry 2020Quote: Aliquots (250 μg total protein) of hippocampal extracts of WAR animals subjected to freeze/thaw were treated with 5 μL of dithiothreitol (Biorad) 50 μg/μL ...
-
bioRxiv - Neuroscience 2020Quote: ... gels (4.5% acrylamide stacking gel and 10% acrylamide resolving gel) and were then transferred to 0.45 µm nitrocellulose membranes (Bio-Rad) using a semi-dry transfer system (Trans-Blot Turbo ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Genomics 2021Quote: ... Libraries generated by the same protocol were pooled and separated on 5% TBE-PAGE on Mini-PROTEAN tetra cell (BioRad) (Suppl.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... a total of 15 μg siRNA (5 μg from each siRNA) was transferred to a 4-mm cuvette (Bio-Rad) and 5-10×106 DCs were added in 200 μl OptiMEM and incubated for 3 min before being pulsed with an exponential decay pulse at 300 V ...
-
bioRxiv - Genetics 2019Quote: ... Protein samples were denatured at 95°C for 5 min in appropriate loading buffer and loaded into precast SDS-PAGE gels (10% polyacrylamide; Biorad). Gels were run at 40 mA for 45 min in 1x running buffer (Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μl of 10-fold diluted cDNAs was used for qRT-PCRs using a CFX96 real-time PCR machine (BioRad) with a SYBR solution (Eurogentec ...
-
bioRxiv - Genetics 2020Quote: ... nduo-5 and ctb-1 with act-1 as control by iQ™ SYBR® Green Supermix (BIO-RAD, #1708880).
-
bioRxiv - Cell Biology 2021Quote: Purified substrates and enzymes were centrifuged (16,000 g, 5 min, 4°C) before protein concentration was determined by Bradford assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: qPCR reactions were carried out in 25 µl total volume containing 5 ng of cDNA sample and 0.3 µM designed primers and SYBR Green Master Mix (Bio-Rad). Amplification was performed by Step One Plus (Applied Bio System ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were denatured by boiling in 1x Laemmli buffer at 95°C for 5 minutes and loaded on a 4–20% gradient gel (BioRad). PVDF membranes were used for proteins wet transfer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad). Membrane was blocked with 5% skim milk in TBST 1x on rocker for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples (10 µg protein) were denatured at 95°C for 5 min in 4x Laemmli Sample Buffer (1610747, Bio-Rad) or Novex NuPAGE LDS Sample Buffer (NP0007 ...
-
bioRxiv - Physiology 2021Quote: ... membrane-enriched fraction: 5 μg per lane) were loaded onto a 7.5% polyacrylamide mini gel (Bio-Rad, Hercules, CA, USA) – alternating between control and high CO2 treatments to avoid possible gel lane effects ...
-
bioRxiv - Immunology 2020Quote: ... and membrane blocking was performed overnight at 4°C in Tris-buffered saline (TBS) containing 0.2% Tween 20 (V/V) (TBST) and 5% (W/V) Blotting-Grade Blocker (Bio-Rad). Following overnight blocking ...
-
bioRxiv - Molecular Biology 2020Quote: ... proteins in loading buffer were boiled for 5 min before loading on to 12-15% SDS-PAGE gels using the Mini-Protean III gel system (BioRad). A protein transfer apparatus (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were stripped using Restore™ Western Blot Stripping Buffer (Cat. number: 21059) following the manufacturer’s protocol and blocked with 5% Blocking-Grade Blocker solution (Bio-Rad) for 2 h at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... All qPCR reactions were performed in a total volume of 5 µl containing 2.5 µl of SsoAdvanced mastermix (Bio-Rad), 2 µl of forward and reverse primers (5 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Mean fluorescence intensity was measured to calculate final concentration in pg/mL using Bioplex200 and Bioplex Manager 5 software (Biorad).
-
bioRxiv - Neuroscience 2022Quote: ... Samples were heated at 95°C for 5 minutes and loaded on 4-15% TGX gels (Bio-Rad, no. 4568083) in running buffer (25 mM Tris ...
-
bioRxiv - Developmental Biology 2022Quote: ... membranes were incubated in a 5 ml 1:1 A:B solution of Clarity Western ECL substrate (BioRad cat. #170-5060) for 5 minutes at room temperature with rotation ...
-
bioRxiv - Genetics 2022Quote: ... Approximately 43µl of the newly formed droplet solution were transferred into a ddPCR 96-well plate and then sealed at 180°C for 5 seconds in the PX1 PCR Plate Sealer (BioRad). PCR was carried out with the following conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... The resin was resuspended in 5 mL of extraction buffer and transferred to a gravity flow column (Biorad, Hercules, CA). After loading ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: The apparent KD of GST-DnaA for the dnaX-ebfC 5’ UTR DNA probe was determined by densitometry from triplicate EMSAs using ImageLab software (BioRad). Lanes were manually set to the EMSA gel ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The membrane was washed for 5 min with TBS-T and then imaged using a ChemiDoc XRS+System (Bio-Rad). For chemiluminescence-based detection of immunoblots ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the hybrid RNA/DNA origami was run on 1.5% agarose gel in TAE buffer (75 mL were poured into a 15 cm x 10 cm gel tray, Biorad) and analysed by in-gel imaging using the specific dye DFHBI-1T as described above with few modifications due to the different gel composition (agarose instead of polyacrylamide ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Microbiology 2022Quote: ... Cell equivalents of ~1.5×106 cells per lane were separated by 10% SDS-PAGE along with the Precision Plus Protein Kaleidoscope standard (BioRad). The fractionated proteins were transferred to a PVDF membrane ...
-
bioRxiv - Neuroscience 2022Quote: ... After resuspension in TeSR/E8 medium supplemented with 5 μM ROCK inhibitor cells were counted with a TC20 automated cell counter (Biorad) and resuspended to get a final concentration of 2 x 10^5 cells/ml ...