Labshake search
Citations for Bio-Rad :
801 - 850 of 3538 citations for Mouse Anti Human Papilloma virus type 18 718 15 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... This was followed by incubation with secondary HRP-conjugated anti-mouse antibody (1:2000; Bio-Rad). Proteins were visualized using the Pierce ECL system (Genetica/Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies for Western blotting included HRP-conjugated goat anti-mouse and -rabbit antibodies (Bio-Rad), or fluorescently labeled donkey anti-mouse and -rabbit antibodies (680RD or 800RD ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were probed with either secondary antibodies goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... the membranes were incubated with a secondary goat anti-mouse HRP antibody (Biorad, Cat# 170-6516) diluted 1:2,000 for 1-2 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 1:5,000 goat anti-mouse IgG (H+L)-HRP (Bio-Rad, catalog number 1706516) in 3% milk in PBS-T and developed as described above.
-
bioRxiv - Immunology 2023Quote: ... and stained with rat anti-mouse CD68 primary antibody (clone FA-11; Bio-Rad, Hercules, CA) followed by biotinylated rabbit anti-rat IgG secondary antibody (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: ... HRP conjugated secondary antibodies used in the study include goat anti-mouse-HRP conjugate (Bio-Rad), goat anti-rabbit-HRP conjugate (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were then incubated with the secondary antibody (HRP-conjugated goat anti-mouse secondary antibodies, BioRAD) in B-TBST for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... An HRP-conjugated goat anti-mouse secondary antibody and the clarity Western ECL substrate (Biorad, 1705060) were used for protein detection ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies for Western blotting included HRP-conjugated goat anti-mouse and -rabbit antibodies (Bio-Rad), or fluorescently labeled donkey anti-mouse and -rabbit antibodies (680RD or 800RD ...
-
bioRxiv - Cancer Biology 2021Quote: ... For immunohistochemistry (IHC) experiments following primary antibodies were used: IgG anti-human CD3 antibody (1:200, clone CD3-12, Bio-Rad) and anti-PCNA antibody (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... Isotypes of HuMAbs in culture supernatant were determined by western blot using anti–human IgG conjugated with horseradish peroxidase (HRP) (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were incubated for one hour either with a 1:5 dilution of Rat anti Human CD3:Alexa Fluor®647 (0.05 mg/mL) (clone CD3-12; Bio-Rad) or with undiluted CD8 (AM22 ...
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were incubated for 2 h at room temperature in HRP conjugated IgG anti-rabbit secondary antibody (Bio-Rad 170-65-15, 1:3000) or Cy5 conjugated IgG anti-mouse secondary antibody (Jackson ImmunoResearch Laboratories Europe Ltd. ...
-
bioRxiv - Microbiology 2021Quote: The specific fluorescence produced during the formation of amplicons/ PCR product from the genomic RNA (converted to cDNA) of Rabies virus was identified by the detector in the qPCR machine (CFX CONNECT, BIORAD). The quantitative result is expressed in terms of relative quantification ...
-
bioRxiv - Pathology 2022Quote: ... with an in-house full virus standard for determination of genome loads on a C1000 thermal cycler with the CFX96 Real-Time System (Biorad).
-
bioRxiv - Neuroscience 2019Quote: ... The membrane was incubated using appropriate HRP secondary antibodies (donkey anti-rabbit 711-035-152, donkey anti-mouse 715-035-150, Jackson Immunoresearch Laboratory and Biorad ChemiDoc XRS System) or fluorescent secondary antibodies (IRDye 800 CW ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were then incubated for 1 h with either anti-mouse or anti-rabbit secondary antibodies conjugated to horseradish peroxidase (Bio-Rad Laboratories, Hercules, CA). Bands were visualized and subjected to densitometric analysis using an Odyssey Fc system (LI-COR Biotechnology ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by addition of primary antibodies at 4 °C overnight with rotation (mouse anti-ϕ3-actin [Proteintech, 66009-1-Ig], 1:1000, and rat anti-χξ-tubulin [YOL1/34, MCA78G, Bio-Rad], 1:1000). The specimen was washed three times with PBST and incubated with secondary antibodies (anti-mouse ...
-
bioRxiv - Microbiology 2023Quote: ... Revelation was performed using a second antibody coupled to the HRP (anti-rabbit or anti-mouse IgG conjugated to horseradish peroxidase, Bio-Rad, 1:5,000 dilution) and detected using the Clarity Western enhanced-chemiluminescence (ECL ...
-
bioRxiv - Microbiology 2024Quote: ... FLAG-tagged proteins were detected using anti-DYKDDDDK tag primary antibodies (Wako, 1E6, 1:5,000 dilution) combined with anti-mouse-HRP secondary antibodies (Bio-Rad, #1706516, 1:5,000 dilution). SigA proteins were detected using anti-SigA85 (1:10,000 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Octamers were visualized using 18% separating (4% stacking) discontinuous Laemmli SDS-PAGE in Mini-Protean gel running system (Bio-Rad) run for 70 minutes at 22mA ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples from PKC and cross-linking assays were loaded on 18% Tris-Glycine Stain-Free gels (Bio-Rad, 5678073 CA); samples from heart lysates were loaded on 10% Tris-Glycine Stain -Free gel (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μg of total RNA from wild-type HEK293T and C6orf203-KO cells were resolved on a 1.5% agarose gel containing 18% formaldehyde and transferred to a ZETA-PROBE GT membrane (Bio-Rad). Probes used for hybridization were 32P-labeled specific antisense ssRNA corresponding to 16S-rRNA gene (or MT-RNR2) ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 sgS and sgN transcripts and 18S rRNA were quantified by ddPCR with specific primers using an automated droplet generator and droplet reader (BioRad).
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cell Biology 2023Quote: ... For each sample 20 μg of K562 cell extracts were loaded on 6-18% hand-casted acrylamide SDS-PAGE gradient gel (40% Acrylamide/bis-Acrylamide solution, BioRad). After separation by electrophoretic run ...
-
bioRxiv - Molecular Biology 2024Quote: ... TBP (Gene ID: 6908) and 18S (RNA18SN5, Gene ID: 100008588) cDNA levels using the CFX Manager 3.1 software (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... All plasmids were transformed into BJ3505 wild-type and elo3Δ strains via electroporation (BIORAD) and plated onto appropriate auxotrophic selection plates.
-
bioRxiv - Cell Biology 2020Quote: ... Transformation of wild-type cells was performed using electroporation using a Gene Pulser (BioRad) and a total of 35,000 clones (35 pools of ~1000 clones/pool ...
-
bioRxiv - Genetics 2021Quote: ... or horseradish peroxidase-conjugated goat anti-mouse secondary antibody conjugate (1:2000 dilution, Bio-Rad laboratories, #1706516). Membranes were incubated in ClarityTM western ECL substrate (Bio-Rad laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... blots were incubated with either horseradish peroxidase (HRP)–conjugated goat anti-mouse antibody (Bio-Rad 170-6516) or HRP–conjugated goat anti-rabbit antibody at a concentration of 1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by secondary HRP- conjugated goat anti-mouse IgG(H+L) (1:10,000 dilution; Bio-Rad, USA), and then developed using the enhanced chemiluminescence procedure (Pierce ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated for at least 16 hours at 4°C with either mouse monoclonal anti-His (1:2,000; AD1.1.10, Biorad) or mouse anti-RNA pol (1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-mouse (#176516; 1:10,000 for Western blot) was from Bio-Rad. Alexa Fluor-conjugated goat antibodies against mouse IgG (1:500 for IF ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP secondary antibodies were used as follows: 1:500 to 1:1000 anti-mouse (BioRad, 170–6516) and 1:500 to 1:1000 anti-rabbit (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed before incubation with 1:2,500 goat anti-mouse StarBright™ Blue 700 (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: Membranes were subsequently probed with horseradish peroxidase (HRP)-conjugated goat anti-mouse or -rabbit IgG (Bio-Rad), diluted 1:5000 in 5% (w/v ...
-
bioRxiv - Immunology 2022Quote: ... The washed membranes were incubated with secondary antibody StarBright Blue 700 Goat anti-mouse IgG (Bio-rad). The proteins were visualized by fluorescence using ChemiDoc MP Imaging Systems (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... Blots were incubated the following day with 0,33μg/ml Goat-anti-rabbit or -mouse HRP (Bio-Rad) in blocking buffer for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2019Quote: ... was used as the primary antibody and Immun-Star Goat Anti-Mouse (GAM)-HRP conjugate (Bio-Rad) was used as the secondary antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used for westerns were: goat anti-mouse IgG horseradish peroxidase (HRP) conjugate (Bio-rad, 1705047) at 1:2000 and goat anti-rabbit IgG HRP conjugate (Bio-rad ...
-
bioRxiv - Cell Biology 2021Quote: Mouse monoclonal anti-Viral V5-TAG antibody (1:5000; clone SV5-Pk1) was purchased from Bio-Rad/AbD Serotec ...
-
bioRxiv - Immunology 2021Quote: ... the membrane was incubated with secondary antibodies Goat Anti-Mouse IgG (H+L)-HRP Conjugate (Bio-Rad) diluted 1:5000 in TBST with 1% BSA for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... as a primary antibody and HRP conjugated goat anti-mouse IgG secondary antibody (BIO-RAD, Catalog # #1706516). Chemiluminescence was detected using film for figure S1 and an Azure c400 imaging system (Azure Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (H+L) secondary antibody was purchased from Bio-Rad (catalog number ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were used: mouse anti-guinea pig CD8 (clone MCA752F, Bio-Rad Laboratories, Hercules, CA), mouse anti-guinea pig CD4 (clone MCA749PE ...
-
bioRxiv - Genetics 2023Quote: HRP secondary antibodies were used as follows: 1:500 to 1:1000 anti-mouse (BioRad, 170-6516), 1:500 to 1:1000 anti-rabbit (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... Secondary antibodies used for immunoblots were StarBright Blue 520 goat anti-mouse (IgG; 1:10,000; Bio-Rad) and Horseradish peroxidase conjugated-goat anti-mouse (IgG ...