Labshake search
Citations for Bio-Rad :
801 - 850 of 7734 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 10-30 µg of protein was resolved on Criterion TGX Precast Midi Protein Gels (Bio-Rad) then a wet transfer onto Immobilon-FL (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples (30 µg total protein) were loaded onto Criterion TGX 4-20% gels (Bio-Rad: 5671094) and resolved via electrophoresis (90 V for 2 hr) ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was combined with 30 mM imidazole then loaded onto an Econo-Column (Bio-rad) containing 5 mL Ni-NTA resin at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... With a Trans-Blot® TurboTM Transfer System (Bio-Rad, 25 V, 1.0 A, 30 min), proteins were transferred on 0.2 µm polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... 30 to 50 mg of total protein was run on Mini-PROTEAN TGX Gels (BIO-RAD) and transferred to Nitrocellulose Membranes (BIO-RAD) ...
-
bioRxiv - Pathology 2024Quote: ... 30 µg of protein was separated on 4-15% tris-glycine gradient gels (BIO-RAD 4561084) and transferred overnight at 4°C to nitrocellulose membranes (Cytiva 10600008) ...
-
bioRxiv - Synthetic Biology 2024Quote: 30 µl of purified AAV were mixed with 10 µl 4x Laemmli Sample Buffer (Bio-Rad), supplemented with 10% 2-mercaptoethanol and denatured for 10 min at 95 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... run at 140 V for 60 min before being transferred onto PVDF membranes (100 V for 100 min) (Bio-Rad). Membranes were blocked in 1x TBST (1x Tris-buffered saline ...
-
bioRxiv - Immunology 2024Quote: ... and dialyzed overnight at 4 °C into 4 L of Experimental Buffer (25 mM Tris, 100 mM NaCl, pH 7.4) with 2 g/L Chelex 100 resin (Bio-Rad) to chelate residual transition metal ions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and permeabilized with 1% Triton X-100 (BioRad) in PBS for 10 min ...
-
bioRxiv - Systems Biology 2022Quote: ... rat anti-F4/80 (BioRad, MCA497R, 1:100) or rabbit anti-CYP2E1 (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... Chelex 100 Chelating Resin (5g, BioRad, Hercules, California) was added to 100 ml of each buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mg of Biobeads SM2 (Bio-Rad, USA) (prepared by sequential washing in methanol ...
-
bioRxiv - Immunology 2022Quote: ... and anti-F4/80 (1:100; Bio-Rad), combined with the secondary Alexa Fluor 555-labeled anti-rat IgG antibody (1:400 ...
-
bioRxiv - Cell Biology 2020Quote: ... FCS was chelated with Chelex-100 resin (BioRad) and added to Ca2+ free FAD medium ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 mg of Biobeads SM2 (Bio-Rad, USA) (prepared by sequential washing in methanol ...
-
bioRxiv - Genetics 2020Quote: ... DNA was extracted using Chelex 100 (Bio-Rad) (10% ...
-
bioRxiv - Microbiology 2023Quote: ... media were treated with Chelex-100 (chelex: BioRad) as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-WIPI2 (MCA5780GA, BioRad, IF 1:100), rabbit anti ATG2B (25155-1-AP ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... rat anti-CD68 (1:100; Bio-Rad, MCA1957GA), mouse anti-MBP (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-CD8 (Bio-Rad, #MCA1768, 1:100), Armenian-Hamster anti-ψ8T-cell receptor (BD Biosciences ...
-
bioRxiv - Microbiology 2024Quote: ... anti-CD163 (Bio-Rad, MCA1853, dilution 1:100), anti-WC-1 (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-BrdU (mouse, 1:100, Bio-Rad, MCA2483GA), anti-NeuN (rabbit ...
-
bioRxiv - Microbiology 2024Quote: ... lysed with 0.1% Triton X-100 (Bio-Rad) in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... permeabilized with 0.1% Triton X-100 (Bio-Rad) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... diluted 1:100 and lytic substrate (BioRad # N246B) diluted 1:50 in lytic buffer (BioRad # N247B) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.3% Triton X-100 (Biorad, Mississauga ON; #1610407) diluted in 1X PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1:100 DAPI (1351303, Bio-Rad, USA). To quench autofluorescence of lipofuscin the sections were washed 5 min in PBS and incubated with 0.1% w/w Sudan Black B (199664 ...
-
bioRxiv - Microbiology 2024Quote: ... TSB treated with Chelex 100 resin (Bio-Rad) was prepared as previously described (29) ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.05% Triton X-100 (Bio-Rad Laboratories) and then incubated in a mixture of primary antibodies and reagents dissolved in TBS containing 0.05% Na-azide (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-mouse Cd45 (1:100, Bio-Rad, #MCA1388), anti-human CD45 (1:100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and mouse anti-BrdU (1:100, BioRad, MCA2060GA). Secondary antibodies included goat anti-rabbit Alexa Fluor 568 (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse anti-CD2 (Bio-Rad #MCA154GA, 1:100), Rabbit anti-RFP (Abcam #ab62341 ...
-
bioRxiv - Neuroscience 2024Quote: ... primary Ab CD68 (1:100, Bio-Rad, MCA1957GA) and secondary Ab anti-rat Cy3 (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-F4/80 (Bio-rad, MCA497GA, 1:100) and anti-CD11b (Abcam AB133357 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...