Labshake search
Citations for Bio-Rad :
801 - 850 of 8214 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... bands or dots were imaged on a chemiluminescence detection system (Bio-rad).
-
bioRxiv - Neuroscience 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5.
-
D-alanylation of Teichoic Acids in Bacilli impedes the immune sensing of peptidoglycan in DrosophilabioRxiv - Immunology 2019Quote: ... qPCR was performed on an iQ5 Real Time PCR detection system (Biorad) using iTaq Universal Syber Green supermix (Biorad) ...
-
bioRxiv - Neuroscience 2019Quote: ... in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Relative quantification of mRNA abundance was performed using Biogazelle qBASE plus-2 software ...
-
bioRxiv - Immunology 2019Quote: ... Detection of the signals were performed using Clarity Western ECL Substrate (BioRad), or SuperSignal West Femto maximum sensitivity substrate (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Signal detection was performed using a ChemiDoc MP Imaging system (Bio-Rad) or with CL-XPosure Film (34089 ...
-
bioRxiv - Developmental Biology 2019Quote: ... or the CFX384 Touch™ Real-Time PCR detection system (Bio-Rad) with the my-Budget 5x EvaGreen (R ...
-
bioRxiv - Microbiology 2019Quote: ... performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Primer efficiency was calculated for each primer set and efficiencies between 95% and 105% were deemed acceptable ...
-
bioRxiv - Immunology 2021Quote: ... and data was analyzed with Sequence Detection System (Bio-Rad CFX-96). The experimental data were presented as fold changes of gene expression of stimulated cells at various time points relative to control ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we used the CFX Connect Real-Time PCR Detection System (Bio-Rad) using TB Green Premix Ex Taq II (Tli RnaseH Plus ...
-
bioRxiv - Immunology 2021Quote: ... on CFX96 real-time PCR detection machine (Bio-Rad, Hercules, CA, USA) with specific primers listed in Supplementary Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the horseradish peroxidase signals revealed with enhanced chemiluminescence detection (ECL, BioRad). Image acquisition and densitometric analysis was performed using ImageLab (v5.2 ...
-
bioRxiv - Bioengineering 2020Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). The same method was used for polarization assays on BMDMs ...
-
bioRxiv - Pathology 2021Quote: ... and CFX96 Touch Real-Time PCR Detection System (Bio-Rad, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Immuno-reactive proteins were detected with Clarity One detection reagent (Bio-Rad) and visualized using the ChemiDoc XRS+ System (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, 1855195) with 1 ng cDNA and primers listed in Table S4 ...
-
bioRxiv - Plant Biology 2021Quote: ... on a Bio-Rad CFX384 Touch detection system (Bio-Rad, Philadelphia, USA). Two viral quantification methodologies were employed – one relative and one absolute – using primers and conditions as described by Chinnaraja and Viswanathan125 ...
-
bioRxiv - Neuroscience 2020Quote: ... and detected in a CFX96 thermal cycler and detection system (Bio-Rad). Primers for circadian gene detection are listed below ...
-
bioRxiv - Neuroscience 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 4.
-
bioRxiv - Microbiology 2021Quote: ... in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and the CFX Maestro™ Real-Time PCR detection system (Bio-Rad). Dilutions of cDNA template for both standards and all unknowns were run in triplicate with reaction volumes of 10 μl ...
-
bioRxiv - Microbiology 2020Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad), and data were normalized to internal control GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run on CFX Connect Real-Time PCR Detection System (BioRad) using Kapa Probe Fast Universal qPCR Kit (Kapa Biosystems #KK4702) ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed using CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The expression levels were normalized to the internal control actin and GAPDH gene expressions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantified in a CFX96TM Real-Time PCR Detection System (Bio-Rad). The levels were normalized to the levels of act-1 and/or pmp-3 cDNA.
-
bioRxiv - Cell Biology 2020Quote: ... The polypeptide bands were detected with Gel DocTM chemiluminescence detection system (BioRad) after incubation with SuperSignal™ West Pico Chemiluminescent substrate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a CFX RT-PCR detection system (Bio-Rad), and relative gene expression was evaluated by SYBR Green (Bio-Rad #1725274 ...
-
bioRxiv - Plant Biology 2022Quote: ... performed on a CFX96 real-time PCR detection system (Bio-Rad Laboratories). The reference gene was selected by comparing the AtUBC9 (ubiquitin conjugating enzyme 9) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Bio-Rad CFX96 touch Real-Time PCR detection system (Bio-Rad). mRNA levels were normalized to their corresponding GAPDH expression levels ...
-
bioRxiv - Neuroscience 2022Quote: ... on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Logarithmic regression was used to plot Ct values against a known number of copies and absolute mtDNA copies number for each sample was calculated as previously described (Gonzalez-Hunt et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... on CFX96 Real-Time PCR Detection System (C1000 Thermal Cycler, Bio-Rad). All primers used in this study are listed in Table EV1.
-
bioRxiv - Microbiology 2022Quote: ... on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, 1855195). Primer sequences can be found in Supplemental Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... and the iQ™5 Real-Time PCR Detection System from BioRad according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX96 Touch Real-Time PCR Detection System (Bio-RAD, 1855196). Changes in gene expression levels were determined relative to the housekeeping gene RPLP0 (5′- CTCTGCATTCTCGCTTCCTGGAG -3′ and 5′- CAGATGGATCAGCCAAGAAGG -3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... in CFX384 Touch™ Real-Time PCR Detection Systems (Bio-Rad Laboratories). To normalize the expression data ...
-
bioRxiv - Neuroscience 2020Quote: ... on a CFX96 Real-Time PCR Detection System (Cat# 1855195, Bio-Rad). The following primers were used ...
-
bioRxiv - Neuroscience 2020Quote: RT-PCR was performed using SYBR green detection master mix (BioRad 430001607) and amplification was normalized to expression levels of Gapdh for each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... in a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad), with each reaction performed at a 20 μl sample volume in an iCycler iQ PCR 96-well Plate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... the polypeptide bands were detected with GelDoc Chemiluminescence Detection System (Bio-Rad). Quantification of relative densitometry was obtained by normalizing to the background and to loading control proteins (ACTB ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by detection with 1:5000 goat anti-mouse IgG-HRP (BioRad) in block buffer for 1 hr ...
-
bioRxiv - Molecular Biology 2020Quote: qRT-PCR was operated on ABI Prism 7500 Sequence Detection System (BioRad, Life Science Research ...
-
bioRxiv - Immunology 2020Quote: ... The bands were visualized using enhanced chemi-luminescence detection system (Bio-Rad) and quantified using NIH Image J software.
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was conducted using CFX Connect Real-Time PCR Detection System (BioRad). All qPCR data was normalized to GAPDH and RPL13 which are used as housekeepers ...
-
bioRxiv - Cell Biology 2020Quote: ... Bands were visualized using enhanced chemiluminescence detection reagents (Millipore, BioRad, and Ozyme) and autoradiographic films (Blue Devil ...
-
bioRxiv - Biochemistry 2020Quote: ... SYBR green detection qPCR was performed on a CFX384 machine (Bio-Rad). Data was analyzed and converted to relative RNA quantity manually or using CFX manager (Bio-Rad) ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5 The expression of individual genes is normalized to expression level of Gapdh ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplification was performed using a CFX384 Real-time Detection System (Bio-Rad). Each reaction was performed in technical triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Canada). Hippocampal and jejunal samples were analyzed in triplicates ...
-
bioRxiv - Microbiology 2019Quote: ... A CFX Connect Real Time PCR Detection System (Bio-Rad, CA, USA) was used to amplify the DNA templates according to the following program ...
-
bioRxiv - Genetics 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 3.