Labshake search
Citations for Bio-Rad :
751 - 800 of 10000+ citations for Glutathione Colorimetric Detection Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and the CFX96 Touch Real-Time PCR Detection System (Bio-RAD, 1855196). Changes in gene expression levels were determined relative to the housekeeping gene RPLP0 (5′- CTCTGCATTCTCGCTTCCTGGAG -3′ and 5′- CAGATGGATCAGCCAAGAAGG -3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... in CFX384 Touch™ Real-Time PCR Detection Systems (Bio-Rad Laboratories). To normalize the expression data ...
-
bioRxiv - Neuroscience 2020Quote: ... on a CFX96 Real-Time PCR Detection System (Cat# 1855195, Bio-Rad). The following primers were used ...
-
bioRxiv - Neuroscience 2020Quote: RT-PCR was performed using SYBR green detection master mix (BioRad 430001607) and amplification was normalized to expression levels of Gapdh for each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... in a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad), with each reaction performed at a 20 μl sample volume in an iCycler iQ PCR 96-well Plate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... the polypeptide bands were detected with GelDoc Chemiluminescence Detection System (Bio-Rad). Quantification of relative densitometry was obtained by normalizing to the background and to loading control proteins (ACTB ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by detection with 1:5000 goat anti-mouse IgG-HRP (BioRad) in block buffer for 1 hr ...
-
bioRxiv - Molecular Biology 2020Quote: qRT-PCR was operated on ABI Prism 7500 Sequence Detection System (BioRad, Life Science Research ...
-
bioRxiv - Immunology 2020Quote: ... The bands were visualized using enhanced chemi-luminescence detection system (Bio-Rad) and quantified using NIH Image J software.
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was conducted using CFX Connect Real-Time PCR Detection System (BioRad). All qPCR data was normalized to GAPDH and RPL13 which are used as housekeepers ...
-
bioRxiv - Cell Biology 2020Quote: ... Bands were visualized using enhanced chemiluminescence detection reagents (Millipore, BioRad, and Ozyme) and autoradiographic films (Blue Devil ...
-
bioRxiv - Biochemistry 2020Quote: ... SYBR green detection qPCR was performed on a CFX384 machine (Bio-Rad). Data was analyzed and converted to relative RNA quantity manually or using CFX manager (Bio-Rad) ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 5 The expression of individual genes is normalized to expression level of Gapdh ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplification was performed using a CFX384 Real-time Detection System (Bio-Rad). Each reaction was performed in technical triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... and a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Canada). Hippocampal and jejunal samples were analyzed in triplicates ...
-
bioRxiv - Microbiology 2019Quote: ... A CFX Connect Real Time PCR Detection System (Bio-Rad, CA, USA) was used to amplify the DNA templates according to the following program ...
-
bioRxiv - Genetics 2020Quote: ... and detected by CFX386 Touch Real-Time PCR detection system (Bio-Rad). Primer sequences for qPCR are listed in Supplementary Table 3.
-
bioRxiv - Microbiology 2019Quote: ... using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Results were analysed using CFX Maestro v4.1.2433.1219 software.
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were developed using an enhanced chemiluminescence detection system from Bio-Rad.
-
bioRxiv - Neuroscience 2019Quote: ... on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). The primers used are presented as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were run on a CFX384 Real-Time PCR Detection System (BioRad). Met Ct values were normalized to Tfrc using ΔΔCt and compared to normal mouse DNA.
-
bioRxiv - Cell Biology 2020Quote: ... in an iQ cycler and iQ5 Multi-color detection system (Bio-Rad). Primers that were used are indicated in the supplementary Table 2 (primers for actin promoter ...
-
bioRxiv - Plant Biology 2020Quote: ... on CFX96 Touch™ Real-Time PCR detection system (Bio-Rad, USA) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Amplification proceeded using a CFX96 Real-Time PCR Detection System (Bio-Rad) to incorporate a unique sample index/tag sequence and the sequencing adaptors for each sample using the following PCR settings ...
-
bioRxiv - Biochemistry 2020Quote: ... coupled to an iQ5 Multicolor Real-Time PCR Detection System (Bio-RAD). 96 well plates were used with each well containing a total volume of 100 µL consisting of 95% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was realized on CFX96 Touch Real-Time PCR Detection System (Biorad). Analysis of input RNA was performed in the same way on 100 ng of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was run on CFX96 Touch Real-Time PCR Detection System (BioRad) with the following thermal profile ...
-
bioRxiv - Microbiology 2021Quote: ... A CFX96 Touch Real-Time PCR Detection system (Bio-Rad Laboratories Ltd) was used with the following conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... using the CFX Connect™ Real-Time PCR detection system (BIO-RAD) with gene-specific primers listed in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Shanghai, China) was used under the following conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... and analyzed using CFX connect Real-Time PCR detection system (Bio-Rad). Primers for the qPCR were purchased from Euroventec (table 2).
-
bioRxiv - Biochemistry 2020Quote: ... following the manufacturer’s protocol in a CFX96-PCR Detection System (Bio-Rad). Complementary DNA (cDNA ...
-
bioRxiv - Physiology 2020Quote: ... performed with the CFX384 Touch Real-Time PCR Detection System (Bio-Rad), PCR master mix LightCycler 480 SYBR Green I Master (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-time PCR was performed on a CFX96 detection system (Bio-Rad) with SYBR Green reagents (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... which was performed on the CFX96 real-time PCR detection system (Biorad). Experimental results were normalized to β-Actin ...
-
bioRxiv - Plant Biology 2022Quote: ... reaction system on the CFX96 Real-Time PCR Detection System (Bio-Rad) with gene-specific primers (Supplementary Table 4)61 ...
-
bioRxiv - Microbiology 2020Quote: ... and a CFX96 Touch Real-Time PCR Detection System Thermal Cycler (BioRad). Primers targeting IP2 and IP4 (RdRp ...
-
bioRxiv - Immunology 2021Quote: ... following manufacturer’s instructions using CFX connect real-time PCR detection system (BioRad) with specific oligonucleotides described previously (6 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analyses were conducted via the CFX Connect Real-Time detection System (BIORAD) and the expression level was determined by using CFX Manager Software (BIORAD) ...
-
bioRxiv - Microbiology 2021Quote: ... The CFX96 Touch Real-time PCR Detection System (Bio-Rad, Hercules, CA) was used for qRT-PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... detection were performed according to standard manufacturer’s protocols (Bio-Rad Laboratories, USA). Antibodies against the following proteins were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Signal detection was performed on the QX200 Droplet Reader (BioRad Laboratories 1864001). Experiment was set to ABS ...
-
bioRxiv - Cell Biology 2022Quote: ... with detection by chemiluminescence using the Clarity Western ECL Substrate (Bio-Rad) and acquisition on a Bio-Rad ChemiDoc MP System.
-
bioRxiv - Cell Biology 2022Quote: ... the detection was performed with Clarity Western ECL Blotting Substrate (Bio-Rad). Mouse anti-phospho-Histone H2A.X Ser139 (1:2,000 ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... the membrane was visualized using enhanced chemiluminescent detection (BioRad Clarity Cat# 1705061) on the ChemiDoc Touch Imaging System (Bio-Rad).
-
bioRxiv - Genomics 2022Quote: ... A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad) was used to quantify the amount of viral RNA present in each sample ...
-
bioRxiv - Microbiology 2022Quote: ... and a CFX Connect Real Time PCR detection system (788BR01742; Bio-Rad). Gene-specific primers LC060/LC061 (gyrA) ...
-
bioRxiv - Microbiology 2022Quote: ... and the iQ5 or CFX96 real-time PCR detection systems (Bio-Rad). We used hsp70 as the reference gene (primers P43 + P44 ...
-
bioRxiv - Microbiology 2022Quote: ... and amplified on the CFX96 Real-Time Detection System (Bio-Rad Laboratories) with the following program ...