Labshake search
Citations for Bio-Rad :
751 - 800 of 5925 citations for 7 Bromo 2 methylimidazo 4 5 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 62 cycles (10′′ 65 °C + 0.5 °C) in the SYBR-Green-Cycler IQ5 detection protocol (Biorad CFX384), performed in 384-well plates (Merck) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Precision Plus Protein Western C ladder (BioRad) and Precision protein Streptactin-HRP conjugate (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction products were resolved on 15% denaturing PAGE gel with 7 M Urea (Bio-Rad #3450091), and was exposed to a phosphor screen (Amersham ...
-
bioRxiv - Molecular Biology 2022Quote: ... and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad) for passive rehydration overnight at 20 °C in a Protean IEF Cell equipment (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 7 min with a constant 2.5 A using a Trans-Blot Turbo transfer system (Bio-Rad).
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Microbiology 2023Quote: ... 7 µg of each cell extract was loaded on a 12% stain-free SDS-PAGE gel (BioRad) and separated by gel electrophoresis at 175 V for 45 min ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Biochemistry 2020Quote: ... The temperature was varied 25 - 95 °C in 0.5 °C increments by using an iCycle IQ5 real-time PCR system (BioRad). Relative fluorescence was measured using excitation and emission wavelengths of 580 nm and 623 nm ...
-
bioRxiv - Molecular Biology 2019Quote: ... primer and probe hybridization temperature that was checked individually by PCR using a gradient ranging from 57.5 to 61.4°C in intervals of 0.8°C (CFX96 Touch™ Bio-Rad), ii ...
-
bioRxiv - Biochemistry 2021Quote: ... MDH2 aliquots were heated to 42 °C for 10 min then returned to 37 °C in a thermocycler (BioRad), while native samples were maintained at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The fluorescence was measured at 512 nm along a temperature gradient from 20 to 100 °C (0.5°C increase every 10 s) in the CFX ConnectTM real-time thermocycler (BioRad) with the Cfx MaestroTM software ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... pH 7) and Western blotting samples were prepared by adding sample buffer (3× Laemmli Sample Buffer 1610747; BioRad) plus 3.57 M β-mercaptoethanol (2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Physiology 2019Quote: ... initiation at 95°C/10 s followed by 45 amplification cycles (60°C/15 s) on the CFX Thermal cycler (Biorad).
-
bioRxiv - Systems Biology 2021Quote: ... followed by 15 s at 95 °C and 60 s at 58 °C for 40 cycles using Biorad CFX384 thermocycler (Biorad). The mRNA levels of genes encoding cytokine expression were normalized relative to the mean levels of the housekeeping gene and compared using the 2−ΔΔCt method as described previously2 ...
-
bioRxiv - Systems Biology 2020Quote: ... reverse transcription for 20 mins at 46 °C and inactivation for 1 min at 95 °C) in a thermal cycler (C1000 Touch, Biorad). TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Systems Biology 2020Quote: ... 40 cycles of PCR denaturing for 5 secs at 95 °C and annealing/extending for 30 secs at 55 °C) in real-time PCR system (CFX384 Touch, Biorad).
-
bioRxiv - Microbiology 2020Quote: ... 73105b and 73106f pseudotyped viruses were incubated at temperatures from 37°C to 50°C for 60 minutes using temperature gradient on PCR thermal cycler (BioRad). Pseudoviruses were then aliquoted in a 96-well culture plate ...
-
bioRxiv - Biophysics 2022Quote: ... The protein sample was incubated at 40°C and 80 °C respectively for 1 h in a PCR cycler (BioRad) with a heated lid to prevent evaporation ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR was carried out in triplicates and was performed at a 2-step reaction with 95°C denaturation and 56°C annealing and extension for 35 cycles on a CFX96 Real-Time System (BIORAD). Relative quantification of target genes was determined using Bio-Rad CFX manager 3.1 software ...