Labshake search
Citations for Bio-Rad :
751 - 800 of 7403 citations for 6 Quinoxalinecarboxylicacid 1 2 3 4 tetrahydro 2 oxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed on 2 μl with the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) and the following primer pairs ...
-
bioRxiv - Systems Biology 2019Quote: ... 272 mM sucrose) were mixed with 2 µg of DNA in a 1mm gapped electroporation cuvette (Bio-Rad). Cells were incubated on ice for 15 min and electroporated using the Gene Pulser XCell™ electroporation system (Bio-Rad ...
-
bioRxiv - Genetics 2019Quote: ... The resulting cDNA was PCR amplified and run on a 2% Certified Low Range Ultra Agarose (Bio-Rad) gel with subsequent extraction using the QIAquick® Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and then the WBC solutions were embedded into 2% agarose plugs (CHEF Genomic DNA Plug Kit, Bio-Rad) to avoid fragmentation of long DNA molecules ...
-
bioRxiv - Developmental Biology 2020Quote: ... Smit1/2 and TonEBP were measured by real time qPCR using SYBR Green I (Bio-Rad, Mississauga ON) and 5 μM of forward and reverse primer mix (Bio-Rad CFX384 ...
-
bioRxiv - Genetics 2021Quote: ... The enriched proteins were dissociated by the addition of 2 x Laemmli sample buffer (161-0737, Bio-Rad) and boiled at 95 °C for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... Gels were dried for 2 h at 80°C and analysed on a Personal Molecular Imager (Bio-Rad). For RNA stability assays ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 50 μM oligo dT primer (Bio-Rad, 1725038) and 1 μl of 25 mM dNTP mix (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Genetics 2019Quote: ... the size of the amplicon was determined by comparison with a 2-kb DNA marker with the use of Quantity One software (version 4.6.7; Biorad), and the number of repetitions was estimated by comparing the size of the product amplified from the Nichols strain ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Captured proteins were separated from beads by incubating beads in 50 μl 2× Laemmli Sample Buffer (Bio-Rad) at 95°C for 25 min ...
-
bioRxiv - Physiology 2023Quote: ... Protein samples were suspended in Laemmli Sample Buffer supplemented with 2-Mercaptoethanol (β-mercaptoethanol) (BioRad Hercules, California – USA). Then ...
-
bioRxiv - Immunology 2022Quote: ... 200 μL of this transformation mix was then aliquoted into pre-chilled 2 mm electroporation cuvettes (Bio-Rad) and electroporated at 1500 V with an average time constant of ∼4.5 ms using a Gene Pulser Xcell Electroporation System (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Physiology 2023Quote: ... and samples of four larvae each were homogenized in 100 μl 2× SDS sample buffer (Bio-Rad #1610737) containing 5% (355 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 ug RNA was used to synthesize cDNA with the iScript™ cDNA Synthesis Kit (Bio-Rad 1708890). The SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad 1725271 ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed using the Promega 2-step kit on a CFX96 Real-Time PCR System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Three hundred micrograms of protein was precipitated using a ReadyPrep 2-D Cleanup Kit (Bio-Rad Laboratories, USA) at −20 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The detergent was removed by three 2-hour incubations with ∼33 mg of Bio-Beads SM2 (Bio-Rad) followed by overnight incubation with ∼50 mg of Bio-Beads SM2 with all incubations occurring at 4°C.
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using 2 μg of total RNA and the iScript cRNA synthesis kit (Bio-Rad). qPCR was performed using the Brilliant III ultra-Fast SYBR green qPCR master mix (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was transferred to an ice-cold 2 mm gap electroporation cuvette (Bio-Rad Laboratories GmbH, Germany), and cells were electroporated with a single pulse at 1.8 kV ...
-
bioRxiv - Genomics 2023Quote: ... Gene panel probe hybridization occurred overnight for 18 hours at 50°C (Bio-Rad DNA Engine Tetrad 2). Subsequent washes the next day removed unbound probes ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were added with equal volume of 2× Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 65.8 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of total RNA was used for cDNA preparation using the iScript cDNA Synthesis Kit (Bio-Rad). A 1/10 dilution of the cDNA was then used for qRT-PCR analysis utilizing the SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Genetics 2019Quote: ... at 4° C with 100 V for 1 hour in 1 x Tris/Glycine Buffer (Bio-Rad, Cat#1610734) and 20% methanol (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Primary antibody staining was performed overnight at 4&C using rabbit anti-mouse Iba-1 (1:500; Wako Chemical Cat #019-19741) and CD68 (1:200; Bio-Rad Cat #MCA1957) with secondary staining performed for 45 minutes RT using Alexa Flour 594 donkey anti-rabbit (1:400 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Biophysics 2019Quote: ... Gel precursor solutions were prepared with 6% v/v acrylamide and 0.2% v/v bisacrylamide (30% acrylamide/bisacrylamide stock 29:1, BioRad), 2 mM LAP photoinitiator (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... followed by purification and size selection on 1% agarose gel with .6 µg/mL ethidium bromide (BioRad Cat#1610433), selecting for the 7,961 bp band ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2020Quote: ... were harvested and resuspended in 1X PBS-NaN3 (0.2%) and embedded in 2% low-melt agarose (Mb grade, BioRad). Agarose plugs were chilled at 4°C for 30 min and then ejected into Proteinase K digestion buffer (1 mg/mL proteinase K ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated in 2-mm cuvettes (600 V, 50 μF, 200 Ω) by using Gene Pulser Xcell (Biorad). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... resolved by size on a 2% agarose gel and imaged on Gel Doc XR+ and ChemiDoc XRS+ systems (Biorad).
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
bioRxiv - Pathology 2019Quote: ... by SDS-PAGE at 100 V for 2 hours in a Mini-PROTEAN® Tetra cell apparatus (Bio-Rad). The Kaleidoscope commercial standard Precision Plus Protein Standard (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse Transcription cDNA synthesis reactions were performed on 0.2 μg −2 μg total RNA with iScript cDNA synthesis kit (BioRad) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... The cDNA was then diluted 10x with water and 2 µl was mixed with iQ SYBR Green Supermix (BioRad) containing 100 nM of forward and reverse primers ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed in 20 μL reactions in triplicate containing 10 μL 2 × SsoFast EvaGreen Supermix (Bio-Rad,), 1 μL of primers (3 μM F and 3 μM R) ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were sealed and incubated at 37°C for 2 h in a T100 Thermal Cycler (Bio-Rad).