Labshake search
Citations for Bio-Rad :
701 - 750 of 6064 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Resulting lipopolysaccharides were separated using gradient 4–20% sodium dodecyl sulfate□polyacrylamide gel (4–20% Mini□PROTEAN® TGX™ Precast Protein Gel, BioRad, Hercules, USA) electrophoresis (SDS□PAGE ...
-
bioRxiv - Neuroscience 2023Quote: 15-20 µg of protein were loaded onto 4-12% Bis-Tris gels (Novex, Cat. no: NP0336BOX) or 4-20% Tris-Glycine extended gels (BIO-RAD, Cat. no: 4561095) for separation and transferred to nitrocellulose or methanol activated PVDF membranes ...
-
bioRxiv - Cell Biology 2024Quote: ... SDS-PAGE was performed either with standard gels (10 – 12% acrylamide depending on protein size with a 4% acrylamide stacking gel) or 4-15% Mini-Protean TGX precast protein gels (Bio-Rad, Hercules, CA, USA) for CRY1 and Histone at constant 160 V ...
-
bioRxiv - Molecular Biology 2021Quote: ... Equal protein loading was confirmed by Coomassie staining of polyvinylidene difluoride membranes (Coomassie Brilliant Blue R-250, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Biochemistry 2023Quote: ... Collected supernatant samples were separated by SDS-PAGE and bands were visualized using Coomassie Brilliant Blue R-250 (Biorad) solution ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were run on an SDS-PAGE gel and stained with Coomassie Brilliant Blue R-250 (Bio-Rad) (not shown) ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 µL fractions were collected and analyzed by SDS-PAGE with Coomassie Brilliant Blue R-250 staining (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... The resulting gels were subjected to staining with Coomassie brilliant blue R-250 (Bio-Safe CBB; Bio-Rad, USA), and individual protein bands were excised for peptide mass fingerprinting (PMF ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on 4-20% gradient gels (BioRad 4561096).
-
bioRxiv - Biophysics 2021Quote: ... Purity was confirmed by SDS-PAGE (4 – 20% TGX, BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were loaded to 4-15% polyacrylamide gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Cancer Biology 2021Quote: ... and separated on 4-15% Protein Gels (BioRad, Cat# 4568084). SPOP protein was probed by using in-house made rabbit anti-SPOP (1:1000) ...
-
bioRxiv - Genetics 2021Quote: ... ran on a 4%-20% polyacrylamide gel (Bio-Rad, #4561096), and transferred to an Immobilon-P polyvinylidene fluoride (PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were loaded onto a 4-12% polyacrylamide gel (BioRad) and electrophoresed at 150V for 10 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... lysates were loaded on 4%–20% polyacrylamide gels (Bio-Rad) and transferred onto a nitrocellulose membrane (Whatman ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°C in a Mini Trans-Blot Cell (Bio-Rad). Membranes were blocked in 3% non-fat dry milk in TBS-T buffer for 30 min at room temperature ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: ... 4–20% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) with Tris/Glycine/SDS running buffer (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... Proteins were resolved on 4 – 20% SDS-PAGE gels (BioRad), transferred to a PVDF membrane (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and cooled to 4°C using a thermal cycler (Biorad). Next ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples were separated via 4-15% SDS PAGE (BioRad) and transferred to a PVDF membrane using the BioRad Turboblot system ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were run on 4-20% Tris Glycine gels (BioRad) and transferred via Wet transfer onto PVDF membranes for immunoblotting with the indicated antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated in 4-20% SDS-PAGE gels (BioRad) and transferred to nitrocellulose membranes using Trans-Blot® Turbo™ system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... then separated using 4-15% gradient SDS-PAGE (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... SDS-PAGE was performed using 4-20% polyacrylamide gels (BioRad) electrophoresed at 120V for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were fractionated on a 4-15% gel (BioRad) and the gels were stained using PageBlue protein staining solution (Fermentas).
-
bioRxiv - Microbiology 2020Quote: ... Protein samples were mixed with 4× Laemmli buffer (Bio-Rad), denatured at 70°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were run on a 4-15% PAA gel (BioRad) under reducing conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and densitometry performed using Image Lab software (ver 4, BioRad)
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run on 4-15% gradient gels (Bio-Rad) at 80-120V and transferred onto PVDF membrane (Immobilon-FL ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded on 4-20% CriterionTM TGXTM gels (Bio-Rad) and migration was performed in a 1X tris-glycine buffer (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... hold at 4°C in a C1000 Thermal Cycler (Biorad). We then performed RT-qPCR for gene expression quantification of the following genes ...
-
bioRxiv - Immunology 2022Quote: ... 4–20% Tris/glycine gels (Bio-Rad, Hercules, CA, USA), as described previously [25 ...
-
bioRxiv - Cancer Biology 2022Quote: ... separated on 4–20% polyacrylamide gradient gels (Bio-Rad Laboratories), and transferred onto nitrocellulose membranes (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4-15% mini PROTEAN Tris-Glycine gel (Bio-Rad), and the gel was transferred to a nitrocellulose membrane by using wet transfer for 3 h at 90 mV or transfer for 10 min at 20 mV with Invitrogen iblot 2 gel transfer device ...
-
bioRxiv - Molecular Biology 2020Quote: ... and loaded onto 4-20% pre-cast TGX gels (BioRad) for electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... and were electrophoresed using 4-12% SDS-PAGE gels (BioRad). Proteins were transferred ...