Labshake search
Citations for Bio-Rad :
701 - 750 of 1536 citations for 6H THIENO 2 3 B THIOPYRAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed with PBS-T 3 times after each step and finally imaged on the ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2022Quote: The secretome samples were fractionated by one-dimensional SDS-PAGE with the Mini-protean® 3 kit (Bio-Rad, USA) using a 12% resolving gel and a 5% stacking gel at 200 V for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 3-Hydroxypropionate samples were eluted through a 300 mm × 7.8 mm Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) at 55 °C using 5 mM H2SO4 (flow rate 0.6 mL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA and RNA were sheared through sonication and dotted (3 µg) on the nitrocellulose membrane (BIO-RAD, Cat No: 1620112). The membrane was baked at 80⁰C for 2 h and blocked-in phosphate-buffered saline (PBS-Tween 0.05% ...
-
bioRxiv - Cell Biology 2022Quote: ... and assays (Table S3) were used for real-time qPCR (Thermo Fisher, Applied Biosystems QuantStudio 3 and BioRad CFX 384) to determine CXCL12 ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated 3 h with a solution containing a secondary goat-HRP anti rabbit (1:10 000) (Biorad) (milk 0.5 % TBST) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a ratio of 1:2 in 100 µL of TE by heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). In Figures ...
-
bioRxiv - Molecular Biology 2022Quote: ... and heating to 95°C for 3 min followed by cooling to 25°C at 0.1 °C/min in a T100 thermal cycler (Bio-Rad). Primer extension assays were performed either as time courses (up to 240 min ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... Free floating sections were blocked with 3% donkey serum and incubated overnight with rat anti-CD68 (1:200, Bio-Rad). Aβ deposition and CD68 staining were both developed with a Vectastain ABC kit and DAB reaction ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2023Quote: ... an equal volume of the cell suspension was added to the chamber of the counting slide (3 technical replicates) and counted with the TC20 automated cell counter (BioRad).
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Protein denaturation before separation was done by treating the cell lysates for 3 min at 95°C in presence of 1x XT Sample Buffer (BioRad) and 1x XT reducing agent (BioRad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... was added to cells and incubated for 3 min prior to sorting into 384-well plates (Bio-Rad Laboratories, Inc) prefilled with lysis buffer using the Sony LE-SH800 cell sorter (Sony Biotechnology Inc) ...
-
bioRxiv - Developmental Biology 2023Quote: ... was added to cells and incubated for 3 min prior to sorting into 384-well plates (Bio-Rad Laboratories, Inc) prefilled with lysis buffer using the Sony LE-SH800 cell sorter (Sony Biotechnology Inc) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed and blocked in 1x TBST with 5% bovine serum albumin before consecutive incubation with primary antibody (see Suppl. Table 3) and horseradish peroxidase-coupled protein A (Cymed) and detection using Clarity Western ECL Substrate (BioRad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2023Quote: For VP protein analysis 3×109-1×1010 vg of purified AAV were mixed with 12.5 µl 4x Laemmli Sample Buffer (Bio-Rad, supplemented with 10% 2-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR program was run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (#1725121, Bio-Rad, Hercules, CA,) using human Il6 and mouse B2m ...
-
bioRxiv - Microbiology 2020Quote: ... incubated with goat α-rabbit 2° antibody conjugated to HRP (1:5000) (Bio-Rad) in TBS-T at room temperature (1 h) ...
-
bioRxiv - Cell Biology 2019Quote: ... and the beads were washed with buffer #2 in Poly-Prep columns (Bio-Rad). Complexes were eluted in two fractions with buffer #2 supplemented with 2.5mM D-biotin ...
-
bioRxiv - Cell Biology 2020Quote: ... and sets of gene-specific forward and reverse primers (ABCA1, CCL-2) (Bio-Rad) and subjected to real-time PCR quantification using the CFX384 Real Time PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 hours at room temperature and developed with ECL (Biorad 40-720-71KIT). Blots were quantified using FIJI software.
-
bioRxiv - Biochemistry 2021Quote: ... followed by detergent removal using 0.8 mg pre-washed Biobeads SM-2 (Bio-Rad) per ml of reaction mix for 2 hours at RT while slowly rolling ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was reverse-transcribed (2 ug) into cDNA (iScript kit, BioRad Laboratories, Hercules, CA) and analyzed by qRT-PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The detergent/lipid/enzyme solution was mixed with SM-2 bio-beads (Bio-Rad) for 2 h at 4 0C to remove the detergent ...
-
bioRxiv - Biophysics 2021Quote: ... Detergent was removed with four rounds of incubation with SM-2 beads (Bio-Rad) at 80mg beads per 1 mL of liposome suspension (2 hrs at 23°C twice ...